The Cobra Event

Alice Austen had a freshly printed fist of the hospitals in the New York City area, with telephone numbers, on her desk. She began calling the hospitals, one by one. She would get an E.R. house-staff doctor and ask him or her a few simple questions. The conversation didn't take long. 'Have you had any emergency cases recently where the patient was in violent terminal seizure?' she would ask. 'We're looking for previously healthy people who suddenly develop seizures that may end in death. These patients may have discoloration of the iris of the eye. There may be a very strong muscular rigidity. The spine bends backward in the shape of a C.'

The reactions she got from the doctors were all over the map. One doctor thought she must be a paranoid schizophrenic. He refused to talk to her unless she could prove that she was really a C.D.C. doctor. Another doctor, a woman, told her that she had been seeing a lot of strep A flesh-eating bacteria — 'cases of people's faces melting off, and arms and legs. These are mostly homeless people. Who knows where they're getting their infections.'

'Are you seeing seizures with any of these patients?' 'No. Not like you're describing.'

After hours of this, she had come up with nothing. It was looking like a dead end.

Then she had a breakthrough. The third case.

She called the St George Hospital on Staten Island. It was a small hospital in an outlying borough of New York City. She reached an emergency-room physician named Tom d'Angelo.

'Yes,' he said. 'I think I've seen this.' 'Can you describe it?'

'It was a woman named — what was her name? — let me get the patient records, hold on.'

'Okay,' d'Angelo continued, with a sound of papers being shuffled. 'Her name was Penelope Zecker. She died here in the E.R. on Tuesday.'

'Who was the attending?' Austen asked.

'I was. I signed the death certificate. Apparently she had been having dizzy spells. She had a history of hypertension. She was on blood-pressure meds. Age fiftythree. Smoker. Someone called 911 — it was her mother. Penny was living with her mother. She was having a seizure. The E.M.T. got her here. She had a cardiopulmonary arrest and we couldn't resuscitate. With her history of hypertension, we figured she must be having an intracranial bleed or an infarct. I think it was a brain bleed. Her pupils were blown — dilated and fixed. She was cooked.'

'Did you do a brain scan?'

'No. We couldn't get her stabilized. She had this dramatic agonal seizure. Her spine bent all the way back and froze. It was really impressive. It scared the nurses. It scared me. I've never seen anything quite like it. Her face twisted up, it changed shape, really. She rolled off the gurney and landed on the floor. Her legs straightened out. Her head went way back. There was incredible muscular tension in the spine. She starting biting the air. The nurses were afraid of being bitten, actually. She bit down on her tongue and almost severed it. Also, it appeared that she had bitten off several of the fingers of her right hand.'

'My God. When did she do that?'

'Before she was admitted. The elderly mother was — well — incoherent. A patient biting off her own fingers. I've never seen that before.'

'Was there an autopsy?' 'No.'

'Why not, in a case like that?'

He paused. 'This is a for-profit hospital,' he said. 'What do you mean?' she said.

'An autopsy?At a for-profit hospital? Who's going to pay for it? The H.M.O.s sure as hell won't pay for an autopsy. We try to avoid autopsies.'

'You try to avoid knowing what happened to a patient, Dr d'Angelo?'

'I'm not going to argue that, Dr Austen. We didn't do an autopsy, okay?'

'I wish I could have looked at her brain tissue. Do you have samples?'

'Bloods and spinal and some lab tests. We don't have tissue samples because we didn't do an autopsy, as I told you.'

'Can you get me the results by tomorrow?' 'Absolutely. I'm glad to help.'

'What did you put on the death certificate?' 'Cerebral vascular accident. Brain stroke.' There was a pause. 'You think this is something infectious?'

'I'm not sure what it is. What's the mother's address and phone number?'

Cells

With a pencil, Austen marked another X on her map, this one at the St George Hospital on Staten Island. Now there were three points of death:

1. Times Square. April 16. Harmonica Man. The index case.

2. St George Hospital, Staten Island. April 21. Penelope Zecker.

3. East Seventy-ninth Street. April 22. Kate Moran. There was still no obvious connection among them. What had they come into contact with? How were these people connected in a biological sense? The term stealth virus came into her mind, but she pushed it out.

She called Walter Mellis. 'Walt, I've found a third possible case.' She described it to him. 'But I think I'm missing something important. There's a pattern that I'm not seeing.'

'What do your instincts say?'

'It's something I've seen, Walt. It's a visual clue. It's staring me in the face and I don't see it.'

By now, the samples of Kate Moran's tissue would have been processed and prepared for viewing in a microscope. Austen went to the O.C.M.E. histology lab and collected a set of glass slides. There was no microscope in her office, so she took the slides to Glenn Dudley's office. 'So how are things going, Dr Austen? Have you solved the mystery yet?' He was dressed in a scrub suit, sitting at a word processor. He had just finished his day's autopsies, and he was writing up his reports. She noticed that he looked tired. His usually perfect hair was mussed, his face was sallow.

She described the Zecker case.

'Interesting,' he said. 'I've got some lab results for the Moran girl.' He pulled out a report. 'She had high uric acid in the bloodstream.' He gave the readings. 'She had a mildly elevated white-blood-cell count in the spinal fluid.'

'Any toxins?' she asked.

'If we'd found any toxins in her blood I would have told you,' he said. He turned away and blew his nose on a laboratory Kimwipe and hurled it into the wastebasket with a gesture of annoyance. Then they sat down, facing each other across the doubleheaded microscope. Dudley chose the slides to look at. First they looked at slices of the girl's liver and lung. Everything seemed normal. Then they looked at slides of vaginal tissue. Austen found an area of what looked to be a blister, and she examined the cells there. Some of them appeared to have angular shadows ^or crystalline objects in their centers, but she wasn't sure.

Austen wanted to look at brain cells. 'Yeah, well, the brain was a bitch to prepare after you chopped it up, Doctor,' Dudley said.

Even so, they searched through fields of Kate Moran's brain cells. Once again, some of the cells — in the nuclei — contained the lumpy shapes.

'Let's look at some kidney,' Austen said. She was thinking about the golden streaks in Kate's kidneys. Together they studied a slide showing tissue of the kidney. The damage was clearly caused by uric acid. Austen saw needlelike shapes.

'Yeah,' Dudley said. 'These are uric acid deposits. This kid had very high uric acid.' The finding was consistent with the blood work. She had been undergoing some kind of kidney failure when she died.

'I'd like to get some of this tissue in an electron microscope,' Austen said to him. 'Get a better image of the objects in the cell nucleus.' An electron microscope uses a beam of electrons to make highly magnified images of the interior structure of cells. It can make an image of virus particles.

'Why don't you just take some stuff back to Atlanta?' he said.

'I will. But I want to follow up on a couple of things here in the city.'

Houston Street

By now, Austen was sure this was an outbreak. The shapes inside the cells were part of the disease. Mental alarms were going off. Back in her office, she stared at the map for a while, pondering what to do. She noticed that her hands were sweaty. The day had practically gone. She opened up the case files and pored over them, looking for details. She was sure there was a detail she'd missed. Harmonica Man was the index case. She had to look more closely at that, although the O.C.M.E. had not been able to establish where he even lived, much less his real name.

There was a knock on the door. It was Ben Kly. 'How are you doing, Dr Austen? I was just checking in on you. You don't look too good.'

'I'm okay. How are you doing, Ben?' 'Do you think this thing is real?'

'I know it's real. Can you help me with something? Do you know your way around the city?'

'Pretty well. I used to drive a mortuary van.'

'The first case was a homeless man, Ben. He was called Harmonica Man. They don't know where he lived, but he had a friend who was with him when he died, a man named Lem. The report says that Lem lives "under East Houston Street." Can you tell me what that means?'

'Sure. He lives under East Houston Street. Like it says.' Kly smiled.

'Can you take me there?' 'Now?'

She nodded.

He shrugged. 'I'll ask the chief.'

'Please, don't, Ben. He may say no. If you would just take me there-'

'We're going to get a transit cop to go with us, okay?' 'I've been all over this city picking up bodies,' Kly said. 'A lot of homeless dead. They call the homeless people skells. The skells die in every crack.'

He and Austen were sitting at a table in Katz's Delicatessen on East Houston Street, on the edge of the Lower East Side. They were eating hot knishes and hot pastrami sandwiches with mild pickles, and drinking coffee. There were two flashlights on the table.

Austen dug into her knish; a knish is a potato turnover. She burned her tongue on the potato. She had not eaten all day again, and she was practically fainting with hunger. The knish seemed to flow into her bones.

Katz's Delicatessen was founded in 1888, when the Lower East Side was a slum populated by Jewish immigrants from Eastern Europe. Katz's is still owned by the Katz family. It has brown varnished walls and Formica tables, and the place is awash in fluorescent light. It is mostly self-service, but there are some waiter tables along one wall. The walls are decorated with photographs of celebrities, such as the police commissioner and Soupy Sales. Always the celebrities are shaking hands with a Mr Katz. There is a photo of Harry Houdini shaking hands with a Mr Katz — Houdini was a regular at Katz's.

You get a ticket when you go inside, and the men behind the counters hold out little nibs of hot pastrami for a taste before you order, so you can judge whether the pastrami is good that day. On the outside the pastrami is as black as tar and covered with grit. On the inside it is delicate, red, juicy, though sometimes a little fatty, but that is the way Katz's customers like it. Occasionally the guys behind the counters give you more than you have ordered, such as two beers instead of one, but they mark only one beer on the ticket, and they say to you in a low voice, 'You wanted one? Speak up next time! Take it, will ya! Don't tell nobody.' There are racks of dry salamis hanging behind an elderly man who will sell you fifty of them if you want, and there are paper signs dangling from the ceiling that say

It rhymes if you say it correctly.

They finished their coffee and carried their tickets over to the cashier, and they went out onto Houston Street and walked westward. Houston Street is a wide, treeless traffic artery. The afternoon was getting along, and traffic was heavy. On the way, Kly used Austen's cell phone to call the Transit Police. He led Austen into a subway-station entrance at the corner of Second Avenue, a stop for the F train. Once in the station, they waited, and eventually a transit officer showed up.

The station platform was a hundred and fifty yards long, and there were no more than three or four other people standing there. It was not a busy station.

Ben Kly looked up at the ceiling. 'We're following Houston Street,' he remarked. 'We're going east.' At the end of the platform there was a metal curtain wall that went from floor to ceiling. There was a strong smell of urine in the air. Kly said that they were facing the East River. 'The tracks of the F line turn south from here,' he explained. 'We're not going that way. There's an abandoned tunnel that goes east.' Kly turned to the transit officer. 'How far's it go?'

The officer was a chunky man with a mustache, and he had a flashlight. 'A ways,' he said.

There was a small swinging gate at the end of the platform. They switched on their flashlights and went through the gate and down a set of steps to the tracks. Kly pointed his flashlight at a dark metal bar running parallel to the tracks. 'That's the third rail, Dr Austen. It's alive. Don't touch it.'

The officer turned to her. 'If a train comes, stand against the wall, okay? In these little spaces. They're safety niches. But I'll stop the train with my light.'

They walked a distance along the tracks. On their left was a wall made of sheet metal. Kly swung his light over it. He found what he was looking for — a hole in the metal — and they bent over and went through. On the other side was a set of abandoned tracks heading east. The rails were rusty, and the crossties were covered with scattered newspapers and trash. They walked along the track bed, casting their lights around. A train rumbled below them, filling the tunnels with a roar.

'That's the uptown F train,' Kly remarked over the sound. 'It's going under us. We're on a bridge.'

The tracks and the ground were covered with black dust.

'Don't kick up that stuff,' Kly said. 'What is it?' Austen asked.

'It's steel dust. It comes off the rails. It builds up in these unused tunnels.'

They played their flashlights around. There were steel columns everywhere, and a vaulted ceiling. There were empty, open doors leading to black spaces. Their feet moved through the black dust, which was very soft, almost silky underfoot. It hushed the sound of their feet. The walls were decorated with graffiti. On the floor were scattered heaps of cardboard, and coils of dried feces. They stepped over a ski jacket, torn, blackened, lying between the tracks, and a furry mat or rug. Austen shone her light on the rug. It was a crushed, mummified dog. There was a bad edge to the air that seemed to come from the dog. Austen heard a snapping sound. She glanced over and saw that the policeman had unsnapped the leather flap on his gun holster.

'Lem?' Kly shouted. 'Hey, Lem!' His voice echoed down the tunnel.

No answer.

'Anybody home?' Kly called. 'Lem!' Austen called.

They moved slowly back and forth for a long while, shining their lights into grim-looking spaces. At one of the openings in the wall both Austen and Kly noticed the sound of many buzzing flies. This surprised Austen. She didn't expect to find flies underground.

He was lying on an aluminum-and-plastic folding lawn chair. He could have been anywhere from thirty to sixty years old. He was a white man. His back was arched deeply, his body wrenched backward into the shape of a crescent moon. His abdomen had swollen to a tremendous size. It was distended, as if he were pregnant with something, and it had turned a molten shiny green in the lower quadrant over the intestinal area. Gases of decay had built up inside the body, swelling it. His mouth and beard were wet with green and black fluid. Cadaver liquids had poured from between his legs, staining his pants. Flies rose and skittered in the air. He seemed to have lost his eyes.

The cop pulled his hand-held radio and switched it to the breaker channel. He stepped backward, then he turned away and coughed. He put his hands on his knees. He coughed again. There were splashing sounds and more coughing in the darkness. 'I hate these kind of ones,' he said at last, wiping his mouth.

Drawing shallow breaths, Austen moved into the smell. She could feel it touching her skin — she could feel her skin receiving an oily coating from the gases, and a metallic taste appeared in her mouth. She was tasting the smell on her tongue.

She knelt down beside the decedent. She opened her knapsack and put on a protective button mask. She handed another mask to Kly. He did not seem to be particularly bothered by the smell. She put on latex rubber gloves. Very carefully she lifted up the man's right hand.

His fingers were intact, but the skin of the hand had sloughed off. It hung loosely about the fingers, a soft, semitransparent parchment. Delicately, she pulled open the fingers. His hand enclosed a collapsed eyeball.

'He enucleated himself, Ben. He pulled out his eyes.' After making a brief examination of the dead man, Austen stood up and looked around the tunnel, shining her light into corners. Lem and Harmonica Man had been friends. Harmonica Man had sometimes hired Lem as a bodyguard, according to the report. Friends and neighbors?

The transit officer was talking on his hand-held radio, reporting the body.

Austen found a steel door a distance down the tunnel. It was a folding door. There was a padlock on it, and there were heaps of what looked like fresh garbage and food containers scattered around the door. 'Ben,' she said.

He came over and looked, and shook the padlock. It opened. The steel loop had been cut with a hacksaw. 'That's a trick. The homeless do it,' he said, pulling open the door.

Behind the door was a cramped space full of electrical cables. Most of the cables ran along a shelf above the ground. 'They sleep up on the shelf,' Kly remarked, playing his light around. 'It's warmer up there.'

Austen stood on a cinder block and looked. There were several empty vodka bottles lined up on the ledge, and more bottles and plastic food containers. And there was a black garbage bag containing something soft.

'Watch out for rats, okay, Dr Austen?'

She felt the bag with her gloved hands, and pulled it down.

The policeman was asking them what they were doing. 'Just a minute,' Austen said.

She opened the bag. It contained a black hooded sweatshirt, balled up in a lump, and a roll of silver duct tape. There was also a clear plastic bag. It contained two Hohner harmonicas.

'Harmonica Man lived here,' she said.

The Transit Police brought the body out in a bag, working with city mortuary drivers. Austen left instructions for them to be especially careful about taking universal biohazard precautions with the body, and she asked that it be placed in a double pouch. She then called Nathanson at his office.

'You can do the' autopsy tomorrow,' Nathanson said. 'The guy's so putrefied, you could wait until Monday, I think.'

'I'd like to do it right now.'

'It's Friday. It's rush hour,' Nathanson said, sighing, but he asked Glenn Dudley to stay while Austen did the autopsy. She couldn't sign the death certificate.

Annoyed, Dudley hurried the body into the X-ray room and took dental X-rays. They were alone in the Pit, except for Kly, who had stayed to help them. All the other tables were empty.

They cut Lem's clothing away, and found that rats had eaten his genitalia.

'They go for that first,' Dudley remarked.

There was what looked like a maggot infestation in his left eye socket. Austen took light breaths, barely able to draw air into her lungs. The smell was so thick it had a greasy quality. She had to force her hands to make the Y incision to open the body.

Dudley stood to one side with his arms folded.

She was cutting now, and as her scalpel crossed the belly, there was a hiss of escaping gas. The abdominal fat had liquefied. It wept oil and stank.

'Oh,' Austen said. She backed away.

'You work around it, Austen,' Dudley said.

Dudley removed the skin hanging from Lem's right hand. It came off easily. He put his rubber-gloved hand inside the skin glove, his fingers sliding up inside Lem's finger-skins. The finger-skins still had fingerprints. Dudley inked the fingertips and rolled a set on a fingerprint pad. She noticed that Dudley's hands were trembling inside Lem's skin. She wondered if Dudley had a drinking problem.

The internal organs were a foul stew. Austen took samples and dropped them into the stock jar. She inspected the mouth carefully. It seemed to be marked with dark spots, possibly blisters, but it was hard to tell.

Dudley said, 'When you look at that meat in a microscope you won't see anything.' The cells had been dead a long time, and they would have ruptured and would appear, at best, like ghosts.

The smell filled the Pit and got out under the doors into the morgue area, where two attendants on the night shift noticed. 'They're doing a mean one in there,' one of them remarked.

Island

The Staten Island ferry left South Ferry Terminal at the tip of lower Manhattan and rumbled across Upper New York Bay, churning through water the color of pavement. It was a gray, misty Saturday morning. Alice Austen stood outside on the forward deck, behind a folding rail, watching Governors Island pass on the left, a low expanse of trees and brick buildings. The trees on Governors Island were breaking bud, bursting into an indistinct bloom, a haze of russet and pale green flowers. Yellow splashes of color suggested to her that the forsythia was in flower. The wind threw her hair around. She looked the other way, at the Statue of Liberty passing in the mist. There weren't many people on the ferry. The deck trembled and bounced under her feet. Delicate small terns with black heads flipped and pirouetted over the water, and a bell buoy passed the boat, clanging.

The boat docked at the ferry terminal at St George, on the northern tip of Staten Island. It was a shorefront of abandoned piers that stretched into the bay. Austen walked through the terminal building, lugging her knapsack, with its weight of computer and notebook, consulting a map. She found the platform of the Staten Island Rapid Transit train, and took a train to Stapleton, then walked inland until she came to Bay Street. She looked left and right, and found a Victorian house with yellow aluminum siding. A sign on the ground floor said 'Island Antiques.' The house was next to a dog-grooming salon. A smell of salt air filled the neighborhood.

Austen found an entryway with a buzzer button, and she pushed it.

Long pause. 'Who is it?'

'It's Dr Alice Austen. We spoke on the phone.'

The buzzer sounded and the lock was released. Austen climbed up a flight of stairs to another door on a landing. 'Walk in,' a voice croaked.

When Austen opened the door a smell of cats hit her. Sitting in a recliner, facing a plate-glass window with a view of warehouses and the bay beyond, was a heavy, wrinkled woman about eighty years old. She was wearing a nightgown with a bathrobe, and slippers. Her ankles were thick, puffy, blue with edema. 'I can't walk good. You have to come over here.'

It was Mrs Helen Zecker, the mother of the decedent. 'I'm working with the City of New York,' Austen said. 'We are trying to find out what happened to your daughter, Penny. We are concerned it might be an infectious disease. We're trying to trace it.'

There was a long pause. Mrs Zecker shifted her bulk and looked at Austen with terrified eyes. 'It got my Penny.'

'What did?'

'The monster thing I kept tellin' the doctors about! They wouldn't listen to me.' She began to cry. Austen sat down on a chair next to her.

'It got my Penny. It'll get me, next.' She waved her hand in a gesture that seemed to say, I'm finished with you.

'May I ask you some questions?'

Helen Zecker rolled around in the chair and looked at

Austen with a tear-streaked face. 'You'd be a darling and feed the cats.'

The kitchen was filthy and disordered. 'The moment Austen opened a can of food, four cats came hurrying in. She filled two teacup saucers with chopped chicken liver, and the cats crowded around them. She rinsed out the cats' water dish and refilled it.

Back in the living room, she said, 'I'm interested in Penny's activities in the time before she died. Can you help me?'

'It got her. That's all I know. It got her.' 'Let's try to figure out what it is that got her.' 'There's all these things happening and they never tell us anything!'

Mrs Zecker's memory of recent days was not good. Her memory of her earlier years was very good. 'I grew up in this house,' she said. 'It was nice before the city went to hell. On New Year's Eve, Papa and Mama, they'd take us up to the attic.' She pointed to the ceiling. 'Papa would open the window up there. It was so cold. We'd have blankets around us.'

'About your daughter, Penny-'

'You could smell the smoke from the freighters coming in the window. On New Year's Eve you'd hear the sailors singing on the ships. Right at midnight, Papa would hold up his hand and he'd say, "Quiet! Listenl" And we'd be quiet. And we'd listen. And it would start. Over there….'

Austen followed her gaze, to where the silver-gray towers of Manhattan seemed to float in the distance. 'It was a roar like the wind,' she said. 'It went on and on.' It was the sound of Manhattan on New Year's Eve. 'I don't hear it anymore.'

Austen sat down on a chair next to her. She touched Mrs Zecker's hand. 'Can you remember? Did Penny go anywhere, do anything unusual? Anything you can remember?'

'I don't know. I don't know…'

'Where did she buy the things for the shop?' Austen asked.

'All over. I don't know. She always paid the taxes. Once she went to Atlantic City. That was a bus tour… My Penny is gone.'

'Do you mind if I look at the shop?' 'I can't go with you.'

'That's all right.'

Mrs Zecker pulled a handle on the side of her lounge chair. The back came forward, raising her up. She put her feet on the floor and grunted. Austen took her by the hands and helped her up, and she shuffled across the room, her slippers dragging. She picked up a coffee cup from a bookshelf, and tipped it over. A key fell out.

Austen went down the stairs, out to the sidewalk, and let herself in through the front door of Island Antiques. She switched on a fluorescent light. It was chilly in the room; the heat was off. The walls were painted lemon yellow, and there was dingy lace trimming around a plate-glass window. A number of glass cases and cabinets displayed cheap-looking 'antiques.' It was really a thrift shop. There was a rack of musty women's. dresses, and a metal desk with the dried remains of a sandwich sitting on a piece of waxed paper. Next to it was a glass ashtray full of cigarette butts. Penny Zecker had been a heavy smoker. There were bookshelves holding forgotten paperback best-sellers. There was an oak display case with items of costume jewelry in it. On the display case was a sign: 'Case not for sale. Don't even ask.' There was a caned rocking chair selling for seventyfive dollars, which seemed a high price, and a scuffed chest made of stained pine selling for forty-five dollars. She opened the chest. Inside was a stack of National Geographics.

This was looking good. Somewhere in this room was a clue. Penny Zecker was a packrat. Like Kate Moran. There was a similarity in their behavior. And they are now dead.

She began making photographs with her electronic camera.

Austen went through the room carefully. There were trays and boxes of kitchen tools. A meat grinder. There were children's toys made of plastic, and a veneered coffee table for sale. A nice-looking brass ship's lamp, for thirty dollars. A Sylvester the Cat jelly-jar drinking glass. A chrome samovar, a lobster buoy. On the walls there were reproductions of snow scenes in frames, everything for sale.

Something was nagging at her. She opened the desk drawer. There were some file folders. She pulled them out, and found a folder marked 'Profits.' In it was a list, handwritten, on lined paper. The list was Penny's way of keeping track of her costs and profits as she bought and sold junk.

There were dates on the sheet, and names. Austen scanned the sheet quickly: '4/18 — small chair- $59 cost $5.' It looked as if Penny had bought a chair for five dollars and had sold it to someone for fifty-nine dollars. Penny Zecker was no fool. She had been keeping herself and her mother alive with her business.

Penny seemed a little obsessive about the entries, but this was her means of survival.

She photographed the page.

Austen said good-bye to Mrs Zecker and promised to let her know immediately if anything further was learned about the cause of the death of her daughter. Back on the ferry she stood at the rear deck, in the open air, looking over Bayonne and down the throat of the Kill Van Kull. Then she walked to the bow of the boat, and watched the stone crystals of Wall Street approach. The clouds were beginning to break apart, revealing a brownish blue on the face of the sky over the city. The city was looking sick, but there was no diagnosis.

She decided to call Walter Mellis at the C.D.C. In the ship's passenger cabin she took out her cell phone and punched up Mellis's home number. The phone beeped at her. The battery had drained.

'Damn,' she whispered.

Feeling more alone than ever, out of contact with the C.D.C., she put the phone in her knapsack and leaned back in her seat. She was exhausted. The ferry ride took almost half an hour, giving her time to think. Austen felt that somewhere in her data there existed a hidden door. If and when she found it, it would lead into a maze of biological systems and relationships, to the inner workings of nature as it played out its billion-year games with the human species.

She opened her laptop computer and started it up. By now she had three memory cards full of images taken with the electronic camera. She slid the memory cards into the computer, one by one, reviewing all the photographs on the computer screen.

Two of the four cases had been people who collect things, namely Kate Moran and Penny Zecker. What about Harmonica Man? He had been a collector, too. He had collected money in his cup, money that had passed through many hands. She didn't know much about Lem.

Hitting keys on her laptop computer, she brought up the images of Kate Moran's art collection. Some were close-ups. There was a geode of crystals, she remembered that. Austen hit a key on her laptop and zoomed the image until it was a checkerboard of pixels: She couldn't see anything. Rocks didn't carry diseases. She zoomed on the image of the box that held the little beetle with the green eyes. No. The image of the dollhouse. Anything unusual in it? She zoomed images of the boxes Kate had collected. A tin box. What was inside it?

She had not taken any photographs of Harmonica Man's things. She and Kly had been in a hurry to get out of the tunnel.

The ledger. Zecker's ledger. She called up the images, and studied the pages. Something caught her eye, something brushed her memory:

6 Ave. flea — black dress — woman — $ 32 cost $0 found garbg.

It was perhaps the kind of dress Kate had liked to wear. But something else got her attention now: Sixth Avenue. Kate's father had mentioned that Kate had bought things at the flea markets, and Austen was pretty sure she remembered him mentioning Sixth Avenue. Kate had bought dresses? Her eye went down the ledger:

Kate had liked boxes.

Austen felt a chill. What in the hell…?

She reviewed the photographs of Kate's bedroom again, one by one, on the screen of her laptop.

Then she found it. A little gray wooden box. It was sitting beside the dollhouse. It was small, rectangular, nondescript. Except for one thing. It had a shape painted on the side. The shape was familiar. It was a polygon, an angular, crystalline shape. She had seen it before.

She blew the image up. Blew it up until it was a maze of pixels. She stared at the painted design on the box. Where have I seen this?

It was the shape of the crystals that she had seen inside Kate Moran's brain. The diagnosis clicked, like a mechanism locking into place.

Kate bought that box from Penny Zecker, at a flea market. The box was the pump handle. She thought: It's sitting in Kate's bedroom now.

Whirlwind

Brain viruses can act fast. A brain virus can take a person from apparent good health to a fatal coma in a matter of hours. Viral agents that grow in the central nervous system spread along nerve cells. You can go to bed healthy and never wake up. By the next morning the agent has amplified itself along the fibers of the central nervous system.

The virus had spent the night amplifying in Peter Talides. His mental state was not good. It was Saturday morning, not a school morning, but he got himself dressed for school and walked to the elevated train station. He took the inbound N train to Manhattan, heading for the Mater School. He rode near the middle of the train, as was his habit. The train clattered over the elevated tracks through Queens, went around a bend, and descended into the tunnels under the East River.

He usually changed trains at the Fifty-ninth Street stop, and from there he would take the Lexington Avenue line uptown. At the Fifty-ninth Street station, he got off the train, as usual. The Lexington Avenue line runs at a lower level, and he walked down a flight of stairs to the mezzanine. The mezzanine is covered with colored mosaics. It is easy to become disoriented there. All the exit doors look alike. The mosaics are of trees and greenery. The tree trunks are red and the leaves are green. On the walls are lines of the poetry of Delmore Schwartz and Gwendolyn Brooks.

Peter Talides should have headed for the door that leads to the uptown train. But he didn't. He failed to read the signs. The colored mosaics disoriented him. He kept going. He passed by words on the wall that said, 'Conduct your blooming in the noise and whip of the whirlwind.'

He passed through a doorway around which shone a huge yellow sun of mosaic tiles. He went down a set of stairs to the downtown side of the Lexington Avenue tracks. A train came along; he stepped aboard. He sat down on a seat, and he was carried away from the Mater School, away from his destination. He sat with his head down almost between his knees. He kept touching his hands to his mouth. His nose was running profusely with clear mucus.

The train carried him along southward, through Manhattan. It dove under the East River and emerged in Brooklyn. At the Borough Hall station in downtown Brooklyn, he seemed to realize he was lost. 'I missed it,' he said in a thick voice.

He got off the train. He went up the stairs and down to the other side, looking at the signs. The higher Peter Talides was reading the signs while the lower Peter Talides was screaming in agony and writhing with disease. His midbrain was dying. He sat down on a bench and bent over and put his head between his knees and stayed that way for a long time. He groaned. Eventually a transit officer named James Lindle arrived at the scene. He touched Talides on the shoulder.

Talides uttered a sharp cry, almost like a baby's cry. It was a startle seizure: a seizure triggered by an intrusion into his world. He fell off the bench to the platform. He curled up on his side and straightened out, his body rigid. The rigidity passed.

A few people stopped and gathered around Peter Talides, but others passed by.

'Stand back, please. Don't touch him,' Officer Lindle said. He called on his radio for an emergency medical squad from the New York Fire Department.

Talides was near the yellow line at the edge of the platform. Suddenly he twisted and rolled off the platform, dropping five feet down to the tracks. He landed with a splash in pools of water in the track bed.

At that moment, the station filled with the rumble of an approaching train.

'Aw, no!' Officer Lindle shouted. He ran up along the platform, waving at the train. 'Stop!'

People were shouting at the man on the tracks: 'Stand up! Get up!'

Talides seemed to hear the people calling to him. His eyes were half open. He was lying in pools of water. He rolled over onto his belly and began to crawl across the tracks — away from help, toward the third rail, the power rail. The train was approaching fast.

The train motorman saw the man crawling on the tracks and dumped his airbrakes on full emergency stop. A subway train can slide five hundred feet along the rails during an emergency stop.

Down on the tracks, a tremor shook Talides, and he flopped over and writhed. His clothing was soaked with water. His body crossed the running rail, and his head wedged itself against the electrified third rail. He grounded the electrical system through his head.

There was a sizzling flash. His body snapped rigid, made rock-hard by ten thousand amps of D.C. electricity running through his head and spine. The circuit breakers did not trip — they almost never trip when a body shorts out the New York subway. Enough electrical current was passing through his skull to accelerate twenty subway cars to full speed. The skin on his face came to an instant boil. A sheet of white blisters passed in a wave over his face. The blisters cratered and turned black.

There was a humming, crackling sound, and his cranial contents boiled. His skull burst with a dull thump. Brain material shot into the air and showered down over the platform. One man was seen wiping his eyes with his hands, then studying his smeared eyeglasses, puzzled by the gray bloody flecks that had seemed to come from nowhere.

An instant later, brakes wailing, the train thudded over the body, cutting it in two, and came to a halt. Smoke began to pour from beneath the car.

Cobra

The housekeeper, Nanette, answered the door. She said that Mr and Mrs Moran were staying with relatives. 'There may be something dangerous in Kate's room. Has anyone been inside?' Austen asked.

No one had been in the room. Kate's parents couldn't bear to go in. Her grandmother was going to go through her things once the worst was over. Mr and Mrs Moran were busy arranging the funeral, which was scheduled for tomorrow.

Austen had studied the photographs, and she had almost every object in Kate's bedroom in her mind's eye. She sat down at the worktable. There in front of her was the box with the rounded, angular crystal painted on it. She reached her hands toward it, stopped. She hesitated. Then she opened her knapsack and pulled out a cardboard box of latex examination gloves. She found a button mask and snapped the rubber band around the back of her head, fixing the mask over her mouth and nose. She found a pair of protective eyeglasses in her knapsack, and she put them on, too. She turned on a desk lamp.

Now, very delicately, she picked the box up. It was about three inches square and was made of some kind of very hard, dense wood. It was a puzzle. There was a sliding catch or mechanism somewhere that would open the box. One of the sides was loose. That might be the opening mechanism.

Should I try to open this? What will happen if I do? Four people are dead, maybe because of this thing. I may already be exposed anyway.

I'm going to open it. 'Ephphatha,' she whispered. Be opened.

She slid her fingers over the box, feeling carefully. There was a click. The box opened and something snapped out of it, fast.

She dropped the box with a yelp. It clattered on the desk.

A snake had popped out: The head and neck of a small wooden snake. It was like a jack-in-the-box. The snake had struck at her fingers, and it had missed. It was a hooded cobra, and its hood was flared open, in the attack stance. It had a red spectacle marking painted across the back of its hood. Its eyes were bright yellow dots with slit irises painted on them. Its tongue was red and forked and stuck out.

The snake was attached to a spring mechanism. When you closed the lid and locked up the puzzle, the spring was cocked. When you pulled on the correct facet, the spring tripped and the snake leaped out and struck at your finger. It was a children's toy. It had been made by hand, perhaps in India or China, she thought.

Something else had come out of the box. She could just see it in the light of the skylight. It was a grayish dust.

She closed her eyes, jerked her head back, held her mask tight on her face, and ran. She found herself standing on the other side of Kate's room. She shivered. She was covered with sweat. What was that dust?

She crossed the room again, breathing as lightly as she could in her mask, holding it tightly down over her face, and she picked up the box in her gloved hand.

The top was open. She looked inside. Nothing there, except the mechanism and a bit of dust. The thing was a dust-dispersion device. Not very efficient. Just enough to put a little bit of dust into the air near the person who opened the box.

'Oh, my God. My God,' she said. It's a bomb. It's" a biological bomb.

She kept her hand on her mask, pushing it down over her nose and mouth, hoping the seal was good. What is the pore size of this mask? Will the mask block these dust particles? The problem was, she didn't know the size of the dust particles. Well, either the dust is getting through the mask or it isn't. If it has gone through, it's too late now.

She turned the box over with her fingertips, rotating it only slightly, so as not to cause any dust to fall out. On the bottom of the box was glued a tiny slip of paper with some words printed on it. The words were very small.

Kate would have had a magnifying glass somewhere around here. She opened a drawer under the table. Then she opened another drawer. There. A magnifying loupe.

She held the box up again, near the desk light, and looked through the loupe at the words. She discerned fine black letters, evidently made by a high-quality laser printer.

She put the box down and looked around the room. The Twinings tea can would do. She got a Kleenex from a pack on Kate's bedside table. She noticed wadded Kleenexes on the floor near the bed. She almost screamed. If Kate had been blowing her nose on them, they would be hot. She didn't touch them. She stuffed a wad of fresh Kleenex into the can, and then gently placed the snake bomb in a nest of Kleenex. She snapped down the can's lid, tight. She held the tea can in her hands. As soon as possible she would have to transfer it to a biohazard bag or container.

The light from the skylight came down around the scene, a cool light, illuminating Alice Austen's red hair. She thought of Kate's red hair, and of the autopsy.

She looked around the room. What is the aircirculation system in this room? She noticed a steam radiator. Good. Forced-air heating ducts might carry the room's air all over the building. She noticed an air-conditioning vent on the ceiling. She would have to make sure the Morans didn't turn on the air-conditioning system.

Austen locked Kate's door from the inside and then went out, and the door clicked behind her. She removed her mask and gloves but didn't know what to do with them. Finally she just put them in a pocket of her knapsack. She also took the magnifying loupe with her.

She found Nanette and warned her not to let anyone go into Kate's room. 'I think I found something in there that may be extremely dangerous. I've locked the door. The authorities are going to investigate. Please keep that door locked until they arrive.'

Nanette promised that she would stay out of the room and would keep people from going in. 'Mr and Mrs Moran won't be home until tomorrow,' she said.

'Whatever you do, don't turn on the air-conditioning.' Austen went out to the street and got a taxi to the medical examiner's office. There, in her office, beside her desk, she had left the bag of Harmonica Man's possessions. She put on a clean pair of surgical gloves and a clean button mask. She opened the mouth of the garbage bag and pulled out the black sweatshirt. There was a lump in the front pocket. She reached into the pocket and pulled out a small box. It was nearly identical to the one from Kate's room. She examined it in the fluorescent light. There was another tiny piece of paper glued to the bottom of this box. With the magnifying loupe, she examined it. This paper contained a picture. It was a very small engineering drawing. A picture of something she had never seen before. It looked like some kind of jar. The jar contained something that looked like a dumbbell or an hourglass. Under the picture was written, in very small print:

The boxes reeked of a plan, and a precise mind.

She locked her office, went up to the histology lab, and asked for several sealable plastic biohazard bags. Telling no one what she needed them for, she returned to her office and bagged the two cobra boxes. She didn't open the tea can. Then she went to the basement and got some large plastic bags, and she triple-bagged Lem's clothing. She realized that her knapsack had been hopelessly contaminated by the rubber gloves and the mask, and she triple-bagged the whole thing and tied it up.

She went to the ladies' room and looked into a mirror over the sink, afraid that she would see something in her eyes. Her eyes stared back at her, gray-blue. There was no change of color. No pupillary ring.

Dr Nathanson lived on the Upper East Side in the Fifties. Austen took a taxi there, and in five minutes she was at the door of his apartment. His wife, Cora, answered the bell. 'Oh, yes, you're the doctor from the C.D.C.,' she said. 'Come in.'

Nathanson had a small office in the apartment. The desk was piled with papers. On the shelves were works of philosophy and medicine. The room smelled of cigars. He shut the door.

She said: 'I've found the source.' 'I'm not sure I follow you.'

'The source. The cause of death. It's a human being. This isn't a natural outbreak. This is the work of a killer.' There was a long pause. In a careful voice, Nathanson said, 'What makes you think so?'

On his desk she placed the orange-and-red plastic biohazard bags that held the tea can and Harmonica Man's box.

'I have found two devices. They are biological dispersion devices — bombs, Dr Nathanson. I found one in Harmonica Man's clothing. I found the other in Kate Moran's bedroom. Penny Zecker was a junk dealer. She sold the device to Kate. Her notebook indicates that somebody traded the box with her for some postcards. That somebody is a murderer.'

She placed her laptop computer on his desk and turned it on. 'Look at these images.'

The chief bent over to stare at her photograph of the Zecker-Moran box.

'This is the device that infected Penny Zecker. She sold it to Kate Moran.' Then Austen held up one of the plastic biohazard bags. 'There's the other device — you can see it in here. It's the device that ended up with Harmonica Man. I think someone may have given it to him in the subway. These boxes are designed to release a small amount of dust into the air when the lid pops open. I think the dust is a dried biological agent. It may be crystallized virus particles, I'm not sure.'

Nathanson said nothing for a long time, staring at the boxes. He picked up the plastic bag, and looked through the plastic at the box inside, at the painted crystal, the featureless gray wood. Suddenly he seemed like an old man. He put down the bag. 'This is criminal evidence. You should have left it where you found it.'

'I–I guess I wasn't thinking about evidence. This is a bomb. I wanted to get it out of there.'

'You've been exposed.'

'So have Glenn Dudley and Ben Kly. You, too. You were present at the Moran autopsy.'

'Jesus! They're doing the teacher now!' 'What?'

'The art teacher. He was killed on the subway tracks.' 'Oh, my God. How?'

'We don't know what happened. I tried to reach you. Your phone wasn't working. I called Glenn and asked him to come in. He's in the autopsy room now with Kly.'

Nathanson called over to the O.C.M.E. and reached a morgue attendant, and asked him to get Dudley on the phone. Soon the man came back, saying that Dr Dudley was busy and would call later.

Knife

Glenn Dudley and Kly were alone in the Pit when Austen arrived there, out of breath. She stopped at the door of the main autopsy room and cried out to them. 'Wait! The body is infected with a hot agent.'

Ben Kly took a step backward.

'It's very dangerous, Dr Dudley,' Austen said.

'Then get yourself suited up before you come in here,' he replied. 'Note my findings.' His gloved finger pointed at Talides's head. 'The facial skin is cratered with blackened pits in the jumping-arc pattern we observe in subway electrocutions. The eyes remain open, milky due to heating. The right temple bulges outward, where we see a cracked-oyster fracture, and here we see traces of cooked brain material spilling out. The smell of cooked brain is distinctive. Why can't I smell it?' Now he looked up at her. His nose was running with a clear mucus, which was flowing over his breathing mask.

'Ben,' she said, backing away.

Kly had been holding the stock jar. He looked at Dudley and the jar dropped from his hands and broke on the floor with a crash.

The sound of the breaking glass may have upset Dudley. A jacksonian twitch rippled across his face. He grunted and opened his mouth. He sighed.

Dudley raised his prosector's knife, hefting it in an expert hand. He turned toward Austen and sighted along the blade, looking at her with shining, alert eyes. The blade was honed carbon steel, more than two feet long, sharpened to the cutting edge of a straight razor, with a wooden grip. It was a weapon of real power, held in the hand of a man who knew how to use it. It was slick with infective blood.

Austen moved backward, keeping her eyes on the blade. Very slowly she raised her hands to protect her neck and face. 'Dr Dudley, please put the knife down. Please,' she said.

Slowly, gently, Dudley moved the knife toward her. She screamed and jumped back, and the knife passed under her arm. He was playing with her, it seemed. 'Over here!' Kly said.

Dudley turned and faced Kly. 'Go!' Kly hissed to her.

She did not move. She picked up a pair of lopping shears, but Dudley spun around and tapped the shears away with his blade. It made a tiny clink.

Dudley turned and moved toward Kly, who backed up, keeping his eyes on Dudley's face, talking to him. 'Calm down, Doctor. Put the knife down. It's all right, Doctor. Let's pray together, Doctor.'

Dudley backed him into a corner. Kly had nowhere to go.

'Let's not pray,' Dudley said, as he swung the knife with all his strength. It passed through Kly's neck with a wet sound, almost beheading him. ,

An arterial jet from his neck hit the ceiling. His head flopped over sideways, the muscles cut. He went down with a slumping sound.

Austen ran out of the room, shouting.

Dudley looked down at Kly, then looked around calmly. His neck arched. His back curved and swayed. The basal writhing intensified. He went over to a supply table and picked up a sterile scalpel blade in a wrapper. He stripped off the wrapper and fitted the little scalpel blade into a handle. He reached above his left ear with the scalpel and poked it into his skin until the tip touched bone, then drew the blade swiftly over the crown of his head, making a coronal incision from ear to ear, the blade tip bumping against the hard bone of his calvarium. He poked the scalpel into his thigh and left it quivering in the muscle — the muscle being a convenient sticking place for the scalpel. With both hands, he reached up and grasped the flap of skin that had opened across his head. He tugged it forward sharply. There was a tearing sound. He pulled his scalp off his skull and turned it inside out. He kept going — expertly, he pulled his face off his cranium. His eyes sagged as he pulled. His scalp fell down over his face inside out, like a slippery red blanket, the dome of his calvarium ivory-colored and red and wet, his hair draped in a fringe down over his mouth. His lips moved behind his hair. He screamed. He was eating his scalp. There was no seizure at the end.

Masaccio

The Jacob K. Javits Federal Building at 26 Federal Plaza in lower Manhattan sits along Broadway, overlooking a complex of courthouses and city government buildings around Foley Square, with a view of the Brooklyn Bridge. The Federal Building is faced with dark gray stone. It has smoked windows. The offices inside include the New York field office of the Federal Bureau of Investigation, which is the largest F.B.I. office in the United States, except for F.B.I. headquarters in Washington. Eighteen hundred special agents and staffers work out of the New York office. It occupies eight floors of the Federal Building.

Alice Austen and the chief medical examiner of New York City entered a darkened conference room on the twenty-sixth floor. The room was full of desks arranged in concentric half-circles, facing a bank of video display screens. It was the Command Center of the New York field office. Various agents and managers and technical people were standing around or sitting at the desks, and there was an unmistakable scent of sour lawenforcement coffee in the air.

A stocky man in his forties came over to them. He had curly brown hair and dark intelligent eyes. He wore a blue oxford shirt under a gray V-neck sweater vest, and khaki pants and L.L. Bean loafers. He had an ample gut.

'Hello, Lex,' he said, and he shook Austen's hand. 'Frank Masaccio. I'm glad to meet you, Doctor. We'll talk in my office.' '

As they walked out of the Command Center, Masaccio gestured to the video screens. 'We're just wrapping up a bust. Insurance fraud.' He shook his head. 'Some of the suspects are doing the fake-heart-attack routine. Half the cardiac-care units in this city have organized-crime figures dying in them as we speak. Drives us nuts.'

Frank Masaccio was the head of the New York field office and an assistant director of the F.B.I. When they got to his office, three floors above, he said to them, 'All right, run this by me again.'

Nathanson's voice was shaky. 'My deputy is dead, infected with something in the autopsy room. He killed our best morgue attendant with a knife, and then he killed himself in a way that is difficult to describe.'

Austen placed her laptop computer on a coffee table. 'Something seems to be causing people to attack themselves or others. We've had six deaths, and it looks like someone is planting the agent in a premeditated way.'

Masaccio said nothing. He got up and crossed the room and sat down on the couch in front of her computer, so that he could see the screen, and he gave her a sharp look. 'The first question I'm asking, is this F.B.I. jurisdiction?'

'This is murder,' she said. She was met with a neutral gaze that was impossible to read as she began to summarize what had happened, what she had found.

Masaccio listened without comment, then suddenly put up one hand. 'Hold on. Have you notified anybody at C.D.C.?'

'Not yet,' Nathanson said.

'I want to do a dial-up with C.D.C.,' Masaccio said. He went over to his desk. Without sitting down, he tapped the keys of his computer, and stared at a fist of numbers and names. 'Here's our contact in Atlanta.' He punched up a telephone number and then tapped in a string of digits with one finger. 'Skypager.'

Within two minutes, the phone rang back. Masaccio put the call on his speakerphone and said, 'Is this Dr Walter Mellis? Frank Masaccio here. I'm the director of the New York field office of the F.B.I. I don't know if we've ever met. I'm sorry to bother you on a Saturday. We have a little problem. Where are you right now?'

'I'm at my golf course. In the clubhouse,' Mellis said. They could hear him breathing hard. It sounded as if he had run for a telephone.

'Walt? It's Alice Austen.' 'Alice! What's going on?'

There was some confusion for a moment about who knew whom, but Walter Mellis quickly explained things to Masaccio.

'Dr Mellis, it looks like we may be in the middle of a — biological event of some kind,' Masaccio said. 'Your researcher seems to have uncovered something.'

'Wait — what's Walt's involvement?' Austen said. 'He's a consultant to one of our special units. It's called Reachdeep,' Masaccio said. He explained that Reachdeep was a classified operation, and that he would arrange for her to have security clearance.

Austen wasn't sure she grasped what was going on. 'Reachdeep is a special forensic unit of the Bureau,' Masaccio said. 'It deals with nuclear, chemical, and biological terrorism. Dr Mellis here is the C.D.C. contact for Reachdeep. He's a consultant for us.'

'Were you in on this?' Austen asked Lex Nathanson. Nathanson was embarrassed. 'Walt has involved me a bit,' he said.

'So he lined you up, Lex?' Masaccio said.

'He asked me to watch for unusual cases. This one seemed unusual.'

Austen was annoyed about being deceived, but she tried to calm herself down. She described to Masaccio in greater detail what she had found, speaking carefully. He interrupted her occasionally to ask questions. She found that she did not have to explain anything twice to him.

'Why did Dr Dudley become so violent?' Masaccio asked. 'That high school kid didn't.'

'The agent seems to exaggerate underlying aggression,' Austen answered. 'Kate Moran was a peaceful person, and she bit her lips. Glenn Dudley was-'

'Very unhappy,' Nathanson filled in, 'to begin with.' 'It's doing damage to primitive parts of the brain,' Austen said. 'If this is an infectious agent, it is one of the most dangerous infective organisms I've ever seen or heard of.'

Masaccio shot a look at Austen. 'How infective? A lot or a little?'

He is asking the right questions, she thought. 'The blistering process in the mouth and nose is an important detail, and it's particularly frightening,' she said. 'You get blistering with very infective agents like smallpox or measles. The agent is not as contagious as the influenza virus. But it is more contagious than the AIDS virus. I would guess it's about as infective as the common cold. It actually starts like a common cold, but then it invades the nervous system.'

'So what is the bug?' Masaccio asked. 'Unknown,' Austen said.

'This has to be federal jurisdiction,' Lex Nathanson broke in. 'The City of New York can't possibly handle this.'

'All right,' Masaccio said. 'What we have is an apparent series of homicides using an unknown biological agent. That's covered under Title 18 of the federal code. That's ours. That's F.B.I. jurisdiction. Can the C.D.C. identify this thing for us?'

'It could be difficult,' Mellis said. 'What about a cure?'

'Cure?' Mellis said. 'How can we cure something if we don't know what it is, Mr Masaccio? If it's a virus, there's probably no cure. Most viruses are untreatable and incurable. Usually the only defense against a virus is a protective vaccine. It takes years of research, and maybe a hundred million dollars, to invent a vaccine for a new virus. We still don't have a vaccine for AIDS.'

Masaccio said, 'Okay, but how long will it take to identify this?'

Mellis answered on the speakerphone, 'Weeks to months.' Masaccio stared at the speakerphone as if he were trying to burn a hole in it with his eyes. 'We have hours to days to deal with this.' He turned. 'So — tell me what you think the virus is, Dr Austen.'

'I don't know what it is. We're not even sure it's a virus.'

There was a silence, and then Masaccio said, 'I have the impression that there's a lot on your mind you're not telling me, Dr Austen.'

'I don't have much evidence.'

'Bullshit. You pulled off a very complex criminal investigation with no backup. Are there any cops in your family? Is your dad a cop, by any chance?'

She didn't say anything.

'Come on,' he said, coaxing her.

'My father, yes. He's a retired chief of police,but what difference does that make?'

Masaccio chuckled, delighted with himself. 'All right, now — good cops work their hunches. Tell me your hunches. One cop to another.'

'It's a virus,' she said. 'It spreads like the common cold: by contact with tiny droplets of mucus floating in the air or touching the eyelids, or by contact with infective blood. It can be dried into a powder and it can get into the air, so it may also be infective through the lungs. It's neuroinvasive — that means it travels along the nerve fibers and invades the central nervous system. It replicates in the brain. It amplifies explosively in the brain. It kills in about two days, so it has a very fast replication phase, as fast as anything I've ever seen. The virus makes crystals in brain cells. The crystals form in the center of the cell, in the cell's nucleus. It damages the brain stem, the areas that control emotion and violence and feeding. The virus causes people to attack themselves and to eat their own flesh. It is not… natural.' 'This is wild speculation,' Mellis said.

'Come on, Walt, you started it when you talked to me about stealth viruses,' Austen said.

'I'm thinking about the Unsub,' Masaccio said. Unsub is Bureau jargon for 'Unknown subject' — the unknown perpetrator of the crime. 'Is this a group or a loner?' Nobody could answer his questions.

'Dr Austen, one thing I have to ask: are you personally contagious?'

'Please don't take me off this case.'

Masaccio grunted. 'Hm… so we could go postal if we've been chatting with you? What a thought.' He rolled a large gold class ring on his finger and made a sucking sound with his teeth. He stood up and crossed to the window, which looked north, toward midtown and the Empire State Building. He put his hands in his pockets. 'Self-cannibalism, spreading through New York like the common cold.' He turned around and faced them. 'I don't have a single goddamned space suit in this office!'

'The fire department has protective suits,' Lex Nathanson said.

'So what can the New York City Fire Department do with a brain virus, Lex? Pour some water on it?'

'I have to inform the director of C.D.C.,' Mellis said.

Frank Masaccio hung up, then turned toward Nathanson and Austen. 'I'm taking this to our National Security Division. The head of the N.S.D. is a guy named Steven Wyzinski.' He punched up another string of numbers. Wyzinski returned the call immediately, and they spoke quietly for a minute or two.

'Steve wants to do a Sioc calldown,' Masaccio said. 'Can anyone tell me why bad things always happen on Saturday night? You can't find anybody in Washington on a Saturday night.'

'What is a — calldown?' Austen asked.

'A Sioc calldown.' He pronounced it Sy-ock. 'That's a meeting of experts and federal people at F.B.I. headquarters. Sioc means Strategic — ah — Strategic — huh. Jesus, I can't remember. Alzheimer's must be setting in. It's the F.B.I.'s command center in Washington. You'll go. Lex and I are going to stay here in New York and get the ball rolling locally. The mayor's office has to be brought into this. I'm going to start lining up a joint task force with the police department — that's an asset. The fire department could be an asset — I'm trying to see the end of this…'

Austen watched him. What she saw was a very bright man working out the opening moves of a chess defense. The problem was that the unknown opponent was in control of the game.

Archimedes

Archimedes of Syracuse, the great mathematician and weaponeer who died in 212 B.C., designed glass lenses or mirrors that focused sunlight on enemy ships and set them on fire. He understood the principle of the lever and the fulcrum, the idea that one can place a long lever on a fulcrum and use it to move a giant mass. `Give me only a place to stand, and I Can move the world,' Archimedes said.

Archimedes liked to ride the subway. He could ride for hours, thinking about things, planning. He sat in the Cars looking at people from behind his metal-framed eyeglasses, a faint smile playing across his face now and again. He was a prematurely balding man of medium height. Usually he wore a tan Cotton shirt and loose, natural-fiber trousers, and sneakers made of canvas and rubber. The clothes were simple but actually quite expensive. He had reasonably friendly feelings toward most people, and it made him feel bad that some of them would have to go.

The subway was the bloodstream of the city, with Connections that ran everywhere. Archimedes liked to study connections. He stood on a platform in Times Square, watching the trains go by. Then he took the shuttle across midtown Manhattan to Grand Central Terminal. He walked briskly through the station, moving among the crowds, listening to their footsteps, looking at the golden constellations overhead in the vaulted space, beautiful Orion the Hunter. He thought of the tracks that go out of Grand Central into the world. People were always talking about viruses from the rain forest that would find their way to modern cities and infect the inhabitants. But it works the other way around, too, he thought. Diseases that emerge from New York City can spread out and reach the humans who live in the rain forest. There are more connections from New York City to the rest of the world than from any other city on earth. Something can explode from here to go everywhere on the planet.

He walked west a few blocks to the New York Public Library, and he Circled around it and sat down on a bench in Bryant Park, among lawns and London plane trees and, of course, people. Too many of them. He sat on a bench and watched them pass before his eyes, the temporary biological Creatures whose lives would not be remembered and who would vanish in the reach of deep time. He looked up at the library, the repository of human knowledge. They are not going to understand my optimism and my hope, he thought. But I think we can be saved. I hold the lever in my hands.

Dash

Before dawn, a New York City police car took Alice Austen from Kips Bay to the East Side Heliport at Thirty-fourth Street. It parked near the landing platform as a Bell turbo helicopter operated by the F.B.I. came down the East River at full power. The helicopter drew up sharply and landed on the platform. Austen ran for it.

On board were two F.B.I. pilots and a tech agent, a woman.

'Frank's really upset about something,' the woman remarked.

'I've never heard him that bad,' one of the pilots said. The woman shook Austen's hand. 'Special Agent Caroline Landau.'

Austen observed that the helicopter was full of racks of electronic equipment. Caroline Landau fiddled with some wires, crimping a cable harness. 'This damned equipment is going to lose our case for us,' she remarked to the pilot.

The helicopter flew straight across Manhattan and up the Hudson River. It turned west across New Jersey and landed at Teterboro Airport, beside a twin-engine turboprop passenger plane. 'Good luck with whatever,' Special Agent Landau said to Austen. Then the helicopter lifted away, to return to its duty over the city.

The turboprop plane was a Dash 8 owned by the F.B.I.

A pilot and copilot were on board, checking their instruments. Austen went up the steps, and the props sputtered and started. The Dash 8 cut into the queue of taxiing planes and was prioritized for immediate takeoff. It climbed to altitude and left New York behind. She looked out the window to try to see the sick organism, but the city was lost in predawn clouds.

She was the only passenger. The other twenty-nine seats were empty.

'If there's anything you need, Dr Austen, please ask us,' the pilot said to her over the loudspeaker.

'I'd like a telephone,' she said.

The copilot walked back and showed her a communications console facing a seat. There was a lot of gear, including several telephones. He picked up a headset and handed it to her. 'It's secure. You can dial anywhere in the world.'

She put on the headset, adjusted the microphone, and called her father in New Hampshire. She woke him up. 'Aw — God. It's five o'clock, Allie,' he said. 'Where've you been? I was calling all over Atlanta. Nobody knew where you were.'

'Sorry, Dad. I'm on a field investigation.' 'I thought so. Where are you?'

'I can't say. It's kind of an emergency.' 'What's that noise I hear?'

'It's nothing important.'

'Aw!' He still sounded groggy. He coughed, and she heard him drinking water. 'Where are you, in a factory or something?'

Her father was living in a small house in the woods near Ashland, New Hampshire. Her mother had died three years earlier. She thought about how excited her father would be if he knew she was calling him from an F.B.I. aircraft headed for Washington. 'Dad, I just wanted to say how much I admire you,' she said.

'You wake me up at the crack of dawn for this?' He chuckled. 'I can take it.'

'I may not have a chance to call you' for a while.' 'Hey — I'm going out to do some fishing. As long as you got me up.'

'What are you going for, Dad?' 'Landlocked salmon. They're still hitting.' 'Yeah. Get some.'

'Keep in touch, sweetie.'

'Good-bye, Dad. I love you.' She sat back in the seat and closed her eyes. That wasn't a perfect good-bye. If I end up like Kate Moran. She got up and went into the plane's washroom and looked at her eyes in the mirror, for the second time that day. She saw no sign of a color change. I hope I'm right about this. I know I'm right. But if I'm wrong, I've just pulled the biggest fire alarm handle in the world, and I didn't even know it existed.

Andrews

Will Hopkins, Jr, and Mark Littleberry had had a few hours layover at the airport in Bahrain, on the Persian Gulf, and they finally had a chance to shave. But they didn't have any clean clothes, and when they hooked onto some spare seats on board a U.S. military airlift command transport 707 bound for Andrews Air Force Base, they looked a little worse for wear.

The flight landed at Andrews at dawn on Sunday morning. Littleberry was due to go out to Bethesda, Maryland, to the National Naval Medical Research Institute, where he would be debriefed about the attempt to obtain a sample of an Iraqi biological weapon. Hopkins had to go to the F.B.I. Academy in Quantico. They had both been fired by the United Nations, they had caused a diplomatic incident, and there was going to be a lot of explaining to do. Still, it was a fine Sunday morning in Washington, and Hopkins was feeling lucky to be alive. 'Let's go over to Georgetown and find a cafe and just sit there,' he said. `Get some coffee, some breakfast, enjoy the sun. You and I need to decompress a little.'

'I can get on this program,' Littleberry said.

He called his wife, Annie, to let her know he was safe. He told her he expected to be back in Boston within a few days, as soon as the briefings were finished. 'Get your bathing suit out, honey, because we're heading for Florida.'

They went in search of a shuttle bus into Washington. They were just arriving at the curb when Will Hopkins's Skypager beeped. It was inside his bag. He unzipped the bag and looked at the number on the beeper. It was not familiar. But he plucked a cell phone from his pocket and dialed the number back. He identified himself and listened for a minute. 'Stoc? What? Oh, man. When is she coming in? I'm supposed to wait for her?' Suddenly, Littleberry looked down and frowned. The beeper in his bag had gone off.

'It's a calldown,' Hopkins said to him.

Littleberry pulled his cellular telephone out and turned it on. It was a secure cell phone on a government band. He walked off to one side. A minute later, he returned. He said, 'Can you give me a lift to the meeting? After you pick up the doctor?'

Hopkins and Littleberry were waiting on the tarmac at Andrews when Alice Austen stepped off the Dash 8. Hopkins said, 'Hi. Supervisory Special Agent William Hopkins, Jr.' He shook Austen's hand. 'This is Dr Mark Littleberry. He is a consultant to the F.B.I. on matters involving biological terrorism. We will accompany you to the meeting.'

Austen thought that Supervisory Special Agent Hopkins was a little underdressed. She noticed the plastic pocket protector. The word geek entered her mind.

An F.B.I. car appeared, and they headed for downtown Washington, traveling very fast. The car threaded sparse traffic on the Beltway, then turned west onto Pennsylvania Avenue.

Hopkins cleared his throat. 'I'm the guy in the Bureau who is supposed to handle a bioterror event. Can you tell us what's going on, Doctor?'

She told them briefly. 'There have been several deaths.

It looks like serial murder using a virus, but we don't have any idea what the virus is.'

'Terror singlets, huh?'

'If that's what you call it,' she said.

'We were sort of figuring on a bomb,' he said. 'These are bombs.'

'It's a onesies and twosies kind of thing.'

'It's murder using a contagious disease,' she said. 'We can handle this,' he said.

Austen looked at him skeptically. 'Do you think so?' The car circled around the Capitol and got back on Pennsylvania Avenue. The cherry trees were past their peak, but the city still glowed with lingering blossoms. A homeless man poked around in a pile of garbage near a restaurant. Their car skirted the north side of the Mall and headed for Ninth Street.

'My turn to say something,' Mark Littleberry remarked.

'Go ahead,' she said.

'We are about to go on air, live, with the whole federal government. You guys ever done that before?'

'Nope,' Hopkins said.

'If you two are jabbing for turf, it's going to look awkward,' Littleberry said.

Austen and Hopkins were silent.

A phenomenally ugly building of monstrous proportions loomed over Pennsylvania Avenue. It was made of raw yellow-gray concrete, with deep-set, bulletproof, smoked windows. It was the J. Edgar Hoover Building, the national headquarters of the F.B.I. The fortress was wider at the top than at the bottom, an upside-down iceberg. The Bureau car turned up Ninth Street and went into the Hoover Building through a security point, around an explosion-barrier, down a ramp, and into a basement garage. They took an elevator to the fifth floor, and came to a door. It was a steel vault door with a combination lock. There was a combination pad on it and a red sign that said, 'Restricted Access — IN USE.' 'Looks like they've already begun,' Will Hopkins said. He punched in an authorization code. A lock clicked, and he pulled open the door. It was the entry foyer of the Strategic Information Operations Center.

SIOC

The Sioc room at F.B.I. headquarters was a windowless, radio-secure chamber. It was lined with copper and steel, so that no stray signals could get out and be caught by an eavesdropper. The interior space of the Sioc chamber was divided into sections that were visible to one another through glass panels. A number of people were sitting around a meeting table in one of the smaller sections.

A tall, silver-haired man in a suit came out to meet them. He was Steven Wyzinski, the head of the F.B.I.'s National Security Division. 'You're William Hopkins? Everyone cleared?'

'These people are basically, sort of, my group,' Hopkins said.

Austen was introduced to a number of F.B.I. officials, but she had trouble remembering their names.

'We'll be going up on the bird in twenty-five minutes,' Wyzinski said, glancing at a clock on the wall. 'We don't have much time. We have to move fast and hard. Please give us all the information you have, Dr Austen.'

Austen opened her laptop computer, showed them the images, and described the situation. They asked her many questions, firing them at her left and right. They wanted to make absolutely sure the event was real before they called in the rest of the government.

'Satellite transmission initiates in four minutes,' someone announced.

'We're going live,' Steven Wyzinski said, rising to his feet. 'Thank you, Dr Austen.'

They filed into the videoconference situation room and sat down at a table, where a sound technician wired them with clip-on microphones. There were a number of large video screens positioned on the walls. The screens were glowing but blank. There were several speakerphones on the table.

Steven Wyzinski adjusted his necktie. He cleared his throat nervously.

One by one, the video screens filled with faces. Voices came on the speakerphones. The room filled with power, real power; you could feel it in the air.

'I'm bringing the meeting to order,' Wyzinski said. 'Welcome to Sioc. This is a threat-assessment meeting for the Cobra Event. The Federal Bureau of Investigation customarily gives a name to major crime investigations and this one will be designated Cobra. You will understand the meaning of the term shortly. This meeting has been called by the Bureau under the mandate of Presidential Decision Directive 39 and National Security Directive 7…'

Austen felt herself trembling, ever so slightly, and she hoped it didn't show. She hadn't slept well in days. Hopkins was sitting next to her.

On two video screens, side by side, were the faces of Walter Mellis and the director of the C.D.C., Helen Lane. Mellis was wearing the full-dress white uniform of the United States Public Health Service, including action ribbons across the chest.

'Congratulations, Dr Austen,' Mellis said. 'Walt? Where are you?' she said.

'Dr Lane and I are at headquarters in Atlanta.' Frank Masaccio's face appeared on another screen. He was with Ellen Latkins, chief of the Emergency Management Office for the City of New York. She was representing the mayor.

Steven Wyzinski introduced Austen, and the calldown people identified themselves. Many of them were highlevel military officers. There was also a man from the office of the Attorney General, at the justice Department.

'Is the White House coming online?' Wyzinski asked. 'White House on now!' said a technician in the background.

A large viewing screen set in a commanding position glowed and went live. It showed a rumpled middle-aged man in a pink polo shirt. He had the air of someone who was used to attending meetings that were choreographed to the minute. 'Yeah. Jack Hertog here. I'm with the National Security Council of the White House. I'm not sure this incident needs a response from us at this point.'.

Wyzinski turned the floor over to Austen.

She stood up and took a breath. Her photographs flashed on the viewing screens. She read the words that were printed on the dispersion devices, the cobra boxes. She said, 'It's a very frightening situation. Six diseaserelated deaths have occurred in a short time.'

'Are we sure that we're dealing with a biological agent?' an Army colonel from USAMRIID, at Fort Detrick, asked.

'I am fairly sure,' Austen said. She explained that there had been infective transmission of the unknown diseasecausing agent in at least two cases. She told them that she suspected that it was a virus.

'If so,' the Army colonel said, 'then it's a Level 4 hot agent. But there's been no identification, right?' 'Correct,' Austen said.

'So how can you assess a threat if you don't know what the agent is?'

'Good point,' Wyzinski said.

'Will, tell us — how bad is this threat?' Frank Masaccio said, addressing Will Hopkins.

'Dr Littleberry should answer that.'

Littleberry leaned forward over the table. The cameras followed him. 'There are a lot of unknowns here,' he said. 'Certainly the identity of the agent, but also the identity of whoever is dispersing it. It's hard to assess the threat, but what we do know is that the lethal-dose response in a population under biological attack can be enormous. A couple of pounds of dry hot agent, released in the air in New York City — you might get ten thousand deaths. The top range would be two million deaths, maybe three million.'

'Your top range seems exaggerated,' said Jack Hertog, the White House man. 'I've seen different estimates in different policy reviews.'

'I sure hope it's exaggerated, son,' Littleberry said. Hertog looked annoyed; people didn't call members of the White House inner staff 'son.'

Ellen Latkins, from the mayor's office, broke in. She had been getting increasingly angry. 'Look, if you people really think that this could escalate to anything even close to the scenario you've described, then I would like to know how you plan on handling this.'

'I share yourconcern,' Jack Hertog said. 'However, you must understand that we have no reason to think that what we have here is a major act of terrorism.' He was thinking to himself: Why did I agree to have my name on the list?

'Wait,' Austen said. 'The deaths have happened very quickly. The disease is unknown. It is explosive in its effects on people. I think we have a problem in New York. There's some kind of murderer out there.'

Hertog smiled. 'There are murderers out there, Doctor.'

'You haven't seen this diseasel' she said.

Steven Wyzinski decided to neutralize things. 'We need to work up an assessment of the threat,' he said. 'The threat is not just the disease but the person or group behind it. The person or group who is called… what is it?'

'Archimedes,' Austen said. 'The words "Archimedes fecit" are Latin. They mean 'Made by Archimedes.' They refer to the cobra box. The date on the box could be the date that Archimedes prepared the box. The expression 'human trial' probably refers to human medical experimentation.'

There followed a great deal of discussion about the motives of Archimedes. The Cobra Event did not seem like classic terrorism, in which a group acts with an agenda. Or if there were an agenda it didn't seem obvious at this point.

Jack Hertog had been getting annoyed with the meeting. The White House had bigger problems to deal with than a killer loose in New York. 'There's been no explicit threat to commit a wide-scale terrorist act,' he said. 'So Dr — ah — Littleberry's projections sound kind of academic.'

Littleberry stood up. 'Hey! One of those photographs that Dr Austen took of the cobra dispersion boxes shows an engineering drawing,' he said to Hertog in a harsh, angry voice. 'It's a bioreactor of some kind. A bioreactor can make a shitload of virus in a real hurry-'

'Thank you, Dr Littleberry,' Hertog said.

Hopkins had been sitting there, wondering when to speak. He was still wearing clothes that needed laundering in the worst way. 'It looks like we could have a very serious situation,' he finally said. 'I think =

'Who are you, again?' Hertog asked.

'Supervisory Special Agent William Hopkins, Jr. I'm a forensic molecular biologist. I'm head of scientific operations for the biology group at the Hazardous Materials Response Unit in Quantico.'

'Oh, yeah. You're that biological SWAT unit that's not ready,' Hertog said.

'We're ready, sir. And we're not a SWAT group. We are scientists.'

'It's my understanding that you're not ready for anything.'

Hopkins sensed that Hertog was losing interest. He said, 'I think we are seeing a pattern. We are seeing a biological terrorist going through a testing phase. That's the meaning of the expression "human trial." For some reason, bioterrorists like to test their stuff. It happened with the Aum Shinrikyo sect in Japan, before they let off nerve gas in the Tokyo subway. They tested anthrax two or three times, and they couldn't get it to work, so they switched to nerve gas. The same thing happened in 1984 in The Dalles, a town in Oregon. The Rajneeshee sect put salmonella in salad bars in restaurants around town, and seven hundred and fifty people got sick. It was a test. They were planning a wide-scale biological attack on the town that was to happen later. What's happening in New York could be the testing phase for a huge release of a biological weapon.'

'This is just speculation,' Hertog said.

'But we can use forensics to stop it,' Hopkins went on. 'Normal forensic science is all about uncovering evidence after a crime has been committed. Here we can use forensics to solve a crime of terror in progress. We have an incredible opportunity to stop a terror event before it happens, using Reachdeep.'

'The unit that doesn't exist,' Hertog said.

Hopkins pulled a swab out of his pocket protector. 'This is the heart of Reachdeep,' he said.

'What?' Hertog said.

'This little swab. The evidence is mainly biological. All terrorist weapons contain signatures — forensic signatures — that lead you back to the perpetrator. When someone makes a bomb, he leaves marks and clues all over it. We can analyze the infective agent, and it will lead us back to its creator.'

'This sounds off the wall,' Hertog said.

Hopkins waved his swab around as he talked. 'The idea behind Reachdeep is universal forensics. You use all your tools, everything you've got, and you take the crime apart. You explore the crime with the limits of your intellect. Exploring a big crime is like exploring a universe. It's what astronomers do when they look at the night sky with telescopes, or what biologists do when they explore a cell with their instruments of vision. You begin to translate the language, and the structure of the crime and the identity of the perpetrator are slowly revealed, like the structure of a universe.'

'For God's sake, Hopkins!' It was Steven Wyzinski. He was embarrassed.

Hopkins put the swab back in his pocket and sat down abruptly. His face was red. He looked sideways at Austen, and then he looked down at the table.

'I've never seen a policy brief on this,' Hertog muttered.

Austen began to feel sorry for Hopkins.

'We need to be invisible,' Hopkins said in a louder voice. 'The perpetrator may accelerate the killing if he, or they, know we're closing in on them. We need to do a secret field deployment of a Reachdeep lab.'

The Army colonel from Fort Detrick said, 'Wait a minute. This man is talking about isolating a hot agent using a portable field laboratory. That's crazy. You need a full-scale Biosafety Level 4 research facility to do that.'

'We're in the middle of an unfolding criminal event,' Hopkins replied. 'We don't have time to fly evidence down to Fort Detrick and then work on it there. Also, if we're flying evidence all over the place, the chain of custody might be damaged. We might lose our ability to get convictions.'

The Justice Department attorney agreed with him. 'We need evidence that can be used in a trial,' he said. Hopkins went on: 'We can move the crime lab to the evidence. I propose we set up a ring of investigative power around a Reachdeep lab. What I mean is, we'll have a core science lab with a forensic team. Around that team, we'll have a joint task force of agents and police officers. The science team will generate leads, but we'll need hundreds of investigators to run out the leads. We need to do good, classical investigative work, and we need to merge it into a Reachdeep forensic operation.'

Jack Hertog of the White House broke in. 'This is over the top. You're asking for a hell of a lot of money and federal attention, and for what? Another Flight 800 media circus that ends up in a hopeless mystery — ?'

'Hey!' Masaccio ripped in. 'My people gave their heart and soul-'

'Shut up, Frank. The F.B.I. forensic lab doesn't exactly have a stellar track record. You people spent twelve years looking for the Unabomber, and in the end, his brother turned him in. Now what do you want to do, act out a sci-fi movie in New York?'

Hopkins looked around the room, seeking support. Steven Wyzinski was hanging back, unwilling to commit himself to a fight with the White House. Frank Masaccio's face was discolored with fury in the video, but he seemed to be reining himself in. There had been too many fights with the White House lately.

Mark Littleberry stood up slowly. 'I think I have something to add here that may put things into perspective. We've never had a situation in this country on any large scale where a population is threatened with a biological weapon. But we've feared this type of event for a long time, and the technology for the development and use of biological weapons is being advanced constantly by people we have no control over, who don't care about the consequences. We learned a lot about how these weapons work during tests in the Pacific in the late 1960s—'

'Excuse me — ' It was Jack Hertog. 'I don't think a discussion of those tests is germane here.'

Littleberry stared at him. 'I don't know if it's germane, but you'd damned well better take it seriously.'

'Of course the President takes this seriously,' Hertog said.

'With a biological weapon,' Littleberry continued, 'you can make people die like flies, depending on the weather and wind, time of day, the way the agent's dried and prepared, the exact method of dispersal, and the nature of the agent itself. Ten thousand deaths in a matter of days would overwhelm all of the city's hospitals. The hospitals would run out of beds and supplies. If the agent was contagious in human-to-human transmission, then just about the first people to die would be the medical caregivers and the first responders. The population of doctors, nurses, firemen, ambulance crews, and police — they'd disappear, fast as hell. There would be nobody left to transport the victims to a hospital and no medical people in the hospitals to treat them. A relatively low end of the range of numbers of possible deaths from a biological weapon could leave the city without any medical-care system at all, except for what could be flown in by the military. The high end of the range is unimaginable — but is technically achievable. And it could happen to any city in the world. Tokyo, London, Moscow, Singapore, you name it. You've got a situation here where any jerk with a hot strain and some understanding of biology can kill a large number of people.'

There was silence in the room. Even Jack Hertog seemed affected by the weight of what Littleberry had said.

It was Steven Wyzinski who finally spoke up. He had been taken aback by Hertog's outburst against the F.B.I., and he wanted to suggest that the Bureau was in control. He said that he felt that even though there was reasonable doubt about the scale of the threat, particularly since there had been no specific target mentioned or demands made, there seemed to be no choice but to start a major investigation. He thought the best chance was Will Hopkins's Reachdeep team.

Everyone agreed that it was so, more or less. 'I can imagine this thing turning into a giant rat fuck,' Hertog said. 'But I think we don't have much choice. The bottom line is, we can't take a chance of a big blowup in a place like New York.'

It was Frank Masaccio who came up with the idea that set the operation in motion. 'I've got a place for you Reachdeep guys,' he said to Hopkins. 'You know Governors Island?'

'Never heard of it,' Hopkins said.

'It's in the middle of New York Bay, right off Wall Street. It's a federal property. Very secure. No media, no people barging in on you. It used to be owned by the Coast Guard, but they've left. They left all their infrastructure there.'

'Okay,' Hertog broke in. 'Hopkins, you put your science squad on the island. And don't screw up. As for USAMRIID and C.D.C., I want you to work in parallel. Both of you are national labs. Both of you will get samples to analyze. If the F.B.I. thing goes down the toilet, both national labs will be there to analyze the disease. Is this agreed?'

The director of the C.D.C. and the colonel from USAMRIID were agreed.

'Sir.' It was the colonel from USAMRIID, speaking to Hertog. 'May I make a suggestion? There has to be some kind of on-site biocontainment field hospital. It could be placed on the island. You do not, repeat do not want any human cases infected with an unknown biological weapon to be put into any New York City-area hospitals. That is just incredibly risky.'

'He's absolutely right,' an admiral from the Public Health Service said.

The Army colonel went on: 'The Army has TAML units that can be palletized and flown under Black Hawk helicopters —'

'I'm sorry,' Hertog said, 'I don't know what a TAML is.' 'Sure — that's a Theater Army Medical Lab. It's a biocontainment hospital in a box. It's rated Biosafety Level 3 Plus. You hang it under a helicopter and you can fly it anywhere.'

'Good.'

'One little item,' Frank Masaccio broke in. 'Dr Alice Austen here opened the Cobra case. We would call her the case agent. I want her sworn in as a deputy U.S. marshal, with full law-enforcement powers. Somebody from justice get her sworn, okay?'

'Thank you, everyone. The first Cobra meeting is closed,' Wyzinski said.

People stood up; the technicians ran around undoing the shirt mikes and moving the video cameras; and the screens on the walls went dead, one by one.

Ouantico

Immediately after the SIOC meeting, Austen and Hopkins took a Bureau car to the F.B.I. Academy in Quantico, Virginia, an hour's drive south of Washington. Mark Littleberry called his wife in Boston, and then set out by himself in another Bureau car to Bethesda, Maryland, to the National Naval Medical Research Institute, to pick up some extra biosensor equipment at the laboratories of the Navy's Biological Defense Research Program, which had been supplying Felixes and Boinks to the F.B.I.

Hopkins talked on his cell phone most of the way down to Quantico. He was 'wickering together a team,' as he put it. He and Austen barely had a word to say to each other. At one point, he looked over and saw that she was asleep. Her hair had fallen off her face, a face that seemed delicate and tired to him, and he noticed faint circles under her closed eyes.

Quantico is a Marine Corps base, and the F.B.I. has an area inside the base. Hopkins turned off Interstate 95 and followed a road westward through rolling woods. He drove through an F.B.I. checkpoint and parked in front of a group of pale-brick buildings that were joined by glassed walkways. It was the F.B.I. Academy, where the Bureau trains new agents and maintains a number of its units, including Hopkins's own group, the Hazardous Materials Response Unit.

'We're here, Dr Austen,' he said. His voice woke her up.

Austen was given a guest room in the F.B.I. Academy, where she changed into operations clothing — cargo pants and a blue shirt — and she ended up with Hopkins at a large gray building known as the Engineering Research Facility, or E.R.F. This building is the F.B.I.'s supersecret electronic-equipment facility. It is a complex of smooth, featureless blocks with smoked windows that reveal nothing of the building's interior. The roof is a forest of radio antennas of all shapes and sizes.

In the lobby of the E.R.F., Hopkins collected a plastic badge for Austen. She entered her Social Security number into a keypad, and a computer system indicated that she had a national security clearance — Frank Masaccio had taken care of that.

She followed Hopkins into a corridor that extended through the center of the building. The corridor was two stories tall, and lined with windows. The windows were covered with black blinds, so that people walking in the corridor could not see what was going on inside the adjacent rooms. 'A lot of these rooms are machine shops,' Hopkins remarked as they walked along. 'We can make anything here. We can put a video camera in an ice-cream cone and take a picture of a mobster's tonsils — just kidding.'

They came to a turnstile and a security door controlled by a computer. They both had to swipe their badges in the turnstile.

'The E.R.F. is divided into security pods,' Hopkins explained. 'The Hazardous Materials Response Unit is scattered through two pods. We are podless. We're kind of new. We're still looking for a pod to call our own.'

They entered a vast indoor chamber, five stories high, called Pod D. The chamber was illuminated with bright lights on the ceiling, and the interior walls were shiny with aluminum foil and copper mesh. The floor of Pod D was crowded with piles of equipment in boxes.

'Is this Reachdeep?' Austen asked. 'It's huge.'

'Oh, no. Most of this is other F.B.I. stuff. We just have a little corner of Pod D.'

'What is this place?' Austen asked.

'It's the radio-silence chamber. The Bureau does electronic work in here.'

Austen didn't ask him what kind of electronic work he meant. She had a feeling she wouldn't get a full answer. Hopkins led her through a warren of makeshift corridors that zigzagged through stacks of boxes and metal storage shelves. They passed an old broken-down pickup truck. The dashboard was open. It was full of communications gear, with data cables hanging out. The truck was a surveillance vehicle.

They emerged into a warren in the middle of an area walled off by boxes where people were working furiously. 'Will! Hey, Will's here!' A man came over to greet them. He was about fifty years old, very fit, with a seamed face and huge shoulders. He was Special Agent Oscar Wirtz, the Tactical Operations officer for Reachdeep — the weapons-and-space-suits man. He was also a logistics specialist. Oscar Wirtz knew how to pack aircraft with gear quickly. This turns out to be a valuable skill in the F.B.I. He was wearing a large black gun in a shoulder holster. He shook Austen's hand with a grip that was not merciful. 'Welcome to Reachdeep,' Wirtz said to her.

Austen met the other team members. They were people whom Hopkins had selected for the operation. Most of the selecting had happened over the telephone, while she had been asleep in the car and Hopkins had been driving.

The team's imaging specialist and microbiologist was a pleasant woman in her late twenties named Suzanne

Tanaka. She was not an F.B.I. agent; she was a civilian laboratory technician. Until recently she had been working for the United States Navy.

'Suzanne was bugging us to hire her,' Hopkins explained, 'so we finally stole her away from the Navy.' 'Should I bring the mice, Will?' she asked.

'Sure, bring a few. Not too many,' he said.

Tanaka busied herself with some plastic boxes holding laboratory mice.

Austen said to her, 'Do you know how to work an electron microscope? Because we need to look at tissue samples right away.'

'Sure,' she said. 'That's my specialty.'

'Suzanne, have we worked out where we're going to get an electron microscope?' Hopkins said.

'The Army's sending us one in a truck. They're also sending someone to show me its quirks.'

'Good,' Hopkins said. 'Those scopes all have quirks.' Hopkins looked at his watch. 'Where's Jimmy Lesdiu? Our materials genius.'

'Right here.'

An extremely tall man stood up from behind a tower of boxes. Special Agent James Lesdiu was a forensic materials analyst. He analyzed hair and fibers, and surfaces and chemicals. He would be coordinating with the F.B.I.'s forensic group in Washington by videoconference during the operation.

'I don't know if I can load this man on a helicopter — he's too tall,' Oscar Wirtz said. Lesdiu was six feet eight inches tall.

'You'd better load me, Wirtzy, because Will can't make this case without me,' Lesdiu replied.

'Here's what I want, Jimmy,' Hopkins said to Lesdiu. 'I want an infrared laser unit. A little weenie one, desktop size.'

'Got it already,' Lesdiu said. He pointed a long, skeletal finger at a gray military transport box.

'Mass-spec machine,' Hopkins went on. 'For identifying materials.'

'Got that, too. It's a little one. What else?'

'I want an X-ray diffraction machine. Small. Portable.' 'Got it. I've got everything you need.'

In a corner of the staging area, a half-dozen men and women, special agents, were sorting their, biohazard space suits and body armor. The space suits were jet black, apparently for use in night operations. They were also making inventory of ten-millimeter handguns, pump-action.00 shotguns, and Heckler & Koch tenmillimeter MP5 assault rifles, along with ammunition, lights, and special breathing equipment. Oscar Wirtz called them up and introduced Austen to them. They were all with the F.B.I.'s Hostage Rescue Team, or H.R.T., which is stationed at Ouantico. 'They're going to handle the operations side of this mission,' Wirtz said, 'if we have an operation.'

They were known in the F.B.I. as ninjas.

'We take turns looking after Will,' said a ninja by the name of Carlos Pedernal.

'That's because Will's a scientist. He can't look after himself,' Oscar Wirtz said.

'You know, we don't need any ninjas,' Will said, stepping around the weapons and looking at them. 'If I need you guys, I'll call for you.'

'Get real, Will,' Wirtz said. 'Look, you want to lean the operations squad forward. Lean 'em way forward. You want to bring them to the island now, Will. If there's an action, it could develop fast.'

Wirtz turned to Austen. 'The idea, in case Will hasn't explained it to you, is that you scientists are the evidence gatherers. If a terrorist weapon goes off, you have to go into a hot zone to gather evidence fast. You may need to have ninjas around you to keep you out of harm's way.' Austen felt like saying that she could take care of herself, but she didn't say anything.

Then Mark Littleberry entered Pod D, accompanied by two F.B.I. agents. They were carrying a total of five Halliburton suitcases. He'd picked up two Felix machines and three Boinks in Bethesda.

The Reachdeep team worked for an hour or so, organizing boxes, taking inventory. Oscar Wirtz and his people began moving equipment out through a door in Pod D to a truck, where the stuff was driven up to the helicopter landing field.

Austen took Littleberry aside. She said, 'Dr Littleberry, could we speak privately? Why do we have to have all the weapons?'

'That's a good question. Hey, Will — come over here for a second. Do we need these armed people? I'm askin' you, Will.'

Hopkins looked thoughtful. 'Let's hope we don't need them.'

Littleberry said, 'If we go into shooters in New York, I'm off the team. I don't do shooters. Dr Austen joins me in this position, I believe.'

Hopkins was exasperated. He was wearing a gun himself. 'Look, Mark, I'm running this team. We're going to do this by the book.'

'By the book, Will?' Littleberry said. 'There isn't any book.'

A man came in, looking surprised at the gear. He was a U.S. marshal from the Department of Justice. 'Where is Dr Austen? I've been sent to deputize her.'

'I don't really want to be a marshal,' she said. 'The government requires it,' he said.

'I can't use a gun.'

'You're not allowed to use a gun,' Hopkins said. 'You aren't weapons-qualified.'

The man from justice swore in both Austen and Littleberry as deputy U.S. marshals.

'Good for you,' Suzanne Tanaka said to Austen. 'I wish they'd do it for me.'

The Hot Core

The helicopters churned north, strung out in a line, traveling at a steady 110 knots. The operations squad followed in helicopters behind the science squad.

'I like Hueys. They're slow as hell but they get you there,' Oscar Wirtz remarked to a pilot.

'We should have taken the Black Hawks,' the pilot said.

Hopkins kept a Felix black box on his knees during the whole flight. For most of the time he worked on it, checking it out, fiddling with his Leatherman tool. He started the Felix and restarted it, testing it. Then he opened the second Felix and checked it out, too. He tested and retested the Boinks.

Littleberry had been sitting near Hopkins in the Huey, almost silent during the flight. 'I'm kind of squirrelly over this, Will,' he said.

The helicopters came up New York Bay over the Verrazano Bridge late in the afternoon. Early that morning, when Austen had left in the F.B.I. plane, the city had been wrapped in clouds. The clouds had turned into fluffy cotton with soft gray undersides, the changeable clouds of spring, and they threw spots of shadow on the buildings below.

'These big operations,' Hopkins said, 'there's nothing like it on earth. The feeling is indescribable.'

Austen had become frankly terrified. She had never been in an air operation, had never seen so many weapons, and she was amazed at how quickly the F.B.I. had put things together. But she had a sense that whenever a government throws its people fast into an unfolding emergency, nobody is in control. Only history is in control, and the story never goes as planned.

As the Reachdeep Hueys approached Governors island, which sat in the East River not far from Brooklyn, the team members saw that other parts of the federal government had already arrived. There was a landing zone in the middle of the island that had once been baseball fields. Two Army Black Hawk helicopters had landed, and a third Army Black Hawk was standing off to allow the Reachdeep helicopters to land first. The Black Hawks had pallets slung under them. They contained hospital gear for a theater medical lab. One by one, the Reachdeep Hueys touched down in the field.

Governors Island is a mile long. It is dotted with abandoned buildings from several historical periods. There are two forts dating from the War of 1812, and there are other buildings put up as recently as the 1970s. Before the American Revolution, Governors Island was where the British colonial governors of New York lived. They chose to live on the island because it put a distance of water between them and the noise and turmoil of the town. Recently the island was owned and operated by the U.S. Coast Guard, but the Coast Guard had moved its operations, leaving the place mothballed.

There were a number of large, graceful brick dormitories on the island. They were trimmed with white paint and had slate roofs, and the largest building had a cupola. The eastern side of the island was separated from Brooklyn by Buttermilk Channel. Three piers stuck out of the island into the channel. A couple of Coast Guard launches were tied up at the piers. Governors Island was so close to lower Manhattan that the towers of Wall Street seemed to loom over it.

The team got their gear out into the field, ducking under the helicopter blades and dragging their boxes. Frank Masaccio was waiting with a group of his senior investigators. He greeted the team, shaking their hands, welcoming them. 'Isn't this a great place?' he said. He put his hands in the pockets of a black trench coat. 'Now it's yours. Don't let the New York office down. I'll be there for you.'

Seagulls were wheeling overhead in the clear light, and a sea breeze rippled across the island. The smell of salt water came off the bay.

Walter Mellis was with Masaccio. He had caught a flight from Atlanta after the SIOC meeting. Mellis was looking scared. He shook Alice's hand. 'Finally I get to congratulate you in person.'

'I wish you had told me.' 'You didn't have clearance.' 'You put me in the F.B.I.'

'You're still C.D.C. We're sending up an epidemic task force.' This was a team of epidemiologists who would monitor the city for any further cases of Cobra, and who would follow up on people who had had contact with potential Cobra cases, so that any spread of the disease in the city would, it was hoped, be kept under control. 'Our labs are ready to do the backup work,' Mellis said to her. 'I'll be flying samples down.'

The F.B.I. helicopters had been offloaded. Two stayed on the island to help ferry people in and out of the city, while the third helicopter returned to Quantico.

On the water's edge at the western side of the island, facing lower Manhattan and the Statue of Liberty, there was an old brick hospital. It was the old Coast Guard base hospital. There was already activity going on there — Army soldiers and officers in green fatigues were hurrying up and down the front steps, carrying equipment and supplies. The idea was to bring the place up to standard as a biocontainment Army field hospital.

An Army colonel in fatigues was standing on the steps. 'You must be Dr Austen. I'm Dr Ernesto Aguilar. I'm chief of the TAML unit,' he said.

'How's the hospital, sir?' she asked him.

'It's got rooms, and that's all we need,' he said. 'In a few hours, this will be a real hospital.'

The hospital was simple and spare, with a pervasive smell of linoleum. Mark Littleberry began prowling around, opening doors. He and Hopkins explored the entire building from top to bottom, getting a sense of how the rooms were structured, where the windows were located, and where the air would flow. Littleberry, the team biohazard officer, found a group of rooms near the back side of the building that he liked — a warren of interconnecting chambers. This area was going to be the Reachdeep lab, the biocontainment core. The rooms were empty, except for a few wooden tables and some metal chairs. There was a large conference area adjacent to the rooms. It looked out through a line of windows across the bay to lower Manhattan and the Statue of Liberty. Outside the conference room there was an observation deck with a metal railing around it. A large investigation requires regular team meetings: this is standard practice. At least once a day all managers of an investigative group meet and share the evidence, trade ideas, and discuss leads that need to be run out.

'This is a good setup, Will,' Littleberry said. 'It beats Iraq,' Hopkins said.

The electronics specialist Austen had met on her way to SIOC, Special Agent Caroline Landau, flew over in a helicopter, bringing with her various types of communication gear. It was combined with the gear that Oscar Wirtz had brought from Quantico. The agents set up a row of satellite dishes on the deck outside the conference room. Inside, Landau put up video monitors, racks of encrypted cellular telephones, and Saber radios. People in conference could make instant visual contact with the Command Center of the New York office or the F.B.I. headquarters in Washington. The gear also included high-speed satellite connections to the Internet and the World Wide Web.

Mark Littleberry planned the layout of the biocontain-ment core, working with Hopkins, Biocontainment of infective evidence was the goal, so that the evidence could be studied safely in a Biosafety Level 3 zone. They called it the Evidence Core.

The Evidence Core was hot. It consisted of three connected rooms. The first room was the materials room, for holding and analyzing the basic physical evidence. There would be a variety of machines in this room. The second room was the biology room, for growing cultures in flasks and for preparing and looking at samples of tissue in regular optical microscopes. The third room, the imaging room, was for the electron microscope and equipment associated with it.

There was a glass window looking from the Core into the conference room. The Core rooms were accessible through a vestibule safety room. This room served as a decontamination chamber, where the team members would put on and take off their protective biohazard gear. They would use bleach in hand-pump sprayers to decontaminate their protective suits. The suits were disposable F.B.I. field biohazard suits.

A Coast Guard ferryboat arrived and docked at the pier on the north end of the island. The boat carried an unmarked white truck. The truck contained the Army's portable electron microscope. The truck was backed up to a loading bay in the hospital, and Army technicians carried the microscope in sections into the imaging room in the Core, and set it up, while Suzanne Tanaka received instructions from them and helped with the work.

The electron microscope was a massive instrument, six feet tall. It used a beam of electrons to make highly magnified images. It was going to be a crucially important tool for making magnified pictures of biological samples. The samples in this microscope would be hot. Since the team needed to have real-time instant access to images, the microscope had to be placed in the Biocontainment Core.

The team's living quarters were situated in an empty Coast Guard dormitory next door to the hospital, in one of the brick buildings. It was surrounded by elm trees and plane trees. Like the hospital, it looked out on New York Bay toward the Statue of Liberty and lower Manhattan. The team members each had his or her own room. The rooms contained a metal bed with Coast Guard blankets and sheets, and that was all.

'We're going to run this forensic investigation around the clock,' Hopkins said to the team. 'When you need to sleep, let people know where you are, and try to keep a sleep session to four hours or less.'

'Aye, aye, Captain Ahab,' Jimmy Lesdiu said.

The operations squad of Reachdeep — Oscar Wirtz's ninjas — had set themselves and their equipment up, and for the moment they had nothing to do. So they cleaned their weapons and checked and double-checked their gear. They hated this kind of waiting. Some of the younger members of the Reachdeep operations squad complained about it to Wirtz. He told them to relax. He pointed out that successful hunters spend most of their time holding themselves still.

The Evidence Core would be kept at Biosafety Level 3 Plus, under negative air pressure. This was so that infective particles would not leak out of the rooms through cracks. Mark Littleberry figured out how to do it. He and Hopkins pounded a hole in one of the exterior walls of the Core, taking turns with a sledgehammer. Then they attached a flexible plastic air duct to the hole, taping all the cracks with sticky duct tape. They ran the duct into a portable HEPA filter unit supplied by the Army. It was essentially a vacuum cleaner attached to the Core. It sucked contaminated air out of the Core and filtered it before discharging the air out a window through a second plastic duct. This system kept the Core in a state of negative air pressure, which is standard for Level 3 Plus. Any dangerous particles in the air would not leak out of the Core, but would flow inward and toward the vacuum cleaner, where they would be trapped in the HEPA filters.

Hopkins threw a switch on the filter machine and it hummed quietly. They finished setting up the airhandling system and had turned it on by nine o'clock in the evening, four hours after the helicopters had touched down on Governors Island.

'We've got negative pressure in the Core now,' Hopkins explained to the others. 'If I must say so myself, this is a gadgetized hot zone.'

'Every time I hear you say that word gadget, Hopkins,' Littleberry said, 'I,know we're in trouble.'

The Reachdeep team gathered in the conference room. Hopkins spoke to them. 'You could think of this lab as a spaceship,' he said. 'We're going to lose touch with the world for a little while, with our families and friends. We are going on a voyage to explore a crime.'

'And to go where no man knows what he is doing,' Suzanne Tanaka said.

'One question, Will,' James Lesdiu said. 'Is this really going to work?'

'I have no idea,' Hopkins said.

'Is it really safe, is what I'd like to know,' Walter Mellis said. He was waiting for samples that he could fly back to Atlanta.

'It's as safe as we can make it,' Mark Littleberry said. Elsewhere in New York City it was a calm spring evening. In the cafes in Greenwich Village, people were gathering at the outdoor tables, drinking and eating. There had been nothing in the newspapers, as yet, about F.B.I. teams landing on Governors Island. The news media had not noticed the increased activity. The Coast Guard had used the island for years as a staging place for rescue operations, and the neighborhoods in Brooklyn closest to the island were accustomed to helicopters coming and going. People did not focus on the fact that the Coast Guard was no longer there, and that the helicopters were from the F.B.I. and the U.S. Army.

Hopkins pondered the question of where to put the Felix gene scanners. They did not need to be operated inside the Core. The Felix system had been developed at Lawrence Livermore National Laboratory, in California, as a system for use by military forces in identifying unknown biological agents. Biological samples for reading in the gene scanners could be sterilized with chemicals before being brought out of the Core. Certain chemicals would kill a virus without disrupting the virus's genetic material. You could put a sterile virus sample into Felix and it would analyze the DNA successfully, even when the organism was dead.

Hopkins found some tables and began setting up the Felixes in the conference room. He placed a few chairs around the tables, and he ran data cables from the Felixes over to the communication center. In that way, Hopkins joined Felix to the World Wide Web.

At seven o'clock in the evening, a Coast Guard ferryboat had arrived at the island bearing a refrigerated morgue truck, courtesy of the City of New York. With the truck came Dr Lex Nathanson. For any autopsies that fell under the jurisdiction of the chief medical examiner — and any deaths in New York City related to Cobra were of that type — Nathanson would be present at the autopsy and would sign the death certificate and seal the evidence.

The morgue truck contained the bodies of Peter Talides, Glenn Dudley, and Ben Kly, sealed in triple body pouches. Nathanson rode in the front of the truck with an F.B.I. evidence specialist who was carrying a large NATO biohazard tube containing the two cobra boxes. They also brought a red plastic biohazard drum containing Harmonica Man's clothes and harmonicas.

Frank Masaccio's people had taken control of Kate Moran's bedroom, the art classroom at the Mater School, Peter Talides's house, and Penny Zecker's shop on Staten Island. The agents were evidence specialists. They were not trained in biohazard work, but they wore respirator masks and coveralls and hoped for the best. It would take them days to sift these locations for further evidence. It was standard operating procedure for a criminal investigation. It had to be done.

'I think we're ready to go hot,' Hopkins said.

Outside the windows of the meeting room came the continual flutter of helicopters bringing in Army hospital equipment, and the Reachdeep team could hear the voices of Army doctors and medical staff moving through the halls of the hospital, setting up rooms for patients as yet unknown.

The team members put on surgical scrub suits and filed into the staging room for the Core. They opened some fiberglass boxes and pulled out black F.B.I. biohazard suits made of Tyvek. They put on rubber boots, and drew on double surgical gloves. The staging room was crowded with team members bumping into one another. 'This is not my idea of fun,' James Lesdiu said, shaking out an extra-large black suit and stepping into it.

Hopkins slung a nylon belt around his suit and hung his Leatherman pocket tool on that. They put on soft, flexible breathing helmets known as Racal hoods, transparent plastic head-bubbles with a filtered air supply. A battery-powered blower, worn at the waist, drives filtered air into the helmet, keeping it under positive pressure, so that infective bioparticles in the air will not sneak in. The batteries for the blowers last eight hours and supply a large volume of filtered air, enough for a person exerting himself heavily. Unlike the Racal hood, the space suit itself is not pressurized. It is a neutral-pressure wholebody suit. The lungs and the eyes are the most vulnerable membranes exposed to the air, so they require the superior protection of a pressurized helmet.

Hopkins fitted a Racal hood over his head, showing the others how to do it. The hood had a kind of double flap that went down over the chest and shoulders. He zipped his suit up over the shoulder flaps of the hood, closing it at the neck. 'We should be able to do a complete suiting procedure in four minutes or less,' he said. 'It's going to be important for us to move in and out of the Core quickly.' He turned to Austen. 'This is a lot easier and simpler than those dinosaur Level 4 space suits you guys have at C.D.C.'

'The dinosaurs work,' Austen said.

'Reachdeep is a small, furry mammal,' he said. 'Go light, move fast, and have sharp teeth.'

'And get stepped on, Hopkins?' she said.

Littleberry pushed open the door, and the team members went into the Core, deploying for their tasks. Hopkins placed the NATO canister on a table. He opened it. He removed a plastic cylinder and opened that.

He removed some paper-towel wadding, and then pulled out the two cobra boxes. They looked exactly alike. The only visible difference between them was the different paper labels glued to their bases. Once the boxes were out in the air, the Core had officially gone hot.

He put the boxes on the table and wrote the word COBRA on a couple of evidence tags. Then he dated the tags and wrote down the laboratory control number of the Reachdeep lab (every evidence lab is assigned a number in the F.B.I.). The sample numbers were 1 and 2.

'I've been thinking about something, Will,' Littleberry said. 'Whoever made those boxes used a lab setup much like this one. Somewhere in this city there's another lab, another Core. And it's running hot, like this one.'

'I like your concept, Commander Littleberry,' Hopkins said. 'It's an Anti-Core. The Anti-Core is out there. And these little things' — he indicated the cobra boxes — 'are going to lead us to it.'

By putting the elements of the forensic investigation together in one place, in a forward field deployment, with living quarters nearby, with an operations group ready, Will Hopkins believed — hoped — that the investigation. could be speeded up and run to a quick conclusion. The idea was to compress a universal forensic operation into a continuous, silent, catlike movement at high speed, culminating in an accelerative explosive rush. The quarry should not know where the hunter was moving. The quarry should not even know that there was a hunter.

Insectary

Archimedes lived in a two-bedroom apartment on the third floor. He kept the shades drawn at all times. The shades were lined with metal foil, to block the sunlight and also to keep snooping eyes from looking into his laboratory with heat-sensing cameras. There were times when he thought he was being watched. At other times he thought he must be paranoid.

He had to keep the apartment dark. He could not allow direct sunlight to enter the laboratory, because sunlight might destroy his virus cultures. He was eating lunch now, in the kitchen. His lunch was a frozen vegetarian burrito, with a tortilla that was free of animal fats. He did not eat meat. He was a parasite on the plant kingdom, but we all have to eat. The problem is that too many humans have to eat. He stood up and opened a door that led to a hallway. The hallway was his Biosafety Level 2 staging area.

In the staging area, he kept a plastic tub full of water and laundry bleach. That was for washing — deconning — objects that were contaminated. There were also some cardboard boxes holding biosafety equipment that he had ordered through the mail from an 800 number. He had his equipment sent to a mail service in New Jersey. Then he drove out and picked up the things in his car. He pulled a clean Tyvek suit out of a box and put it on.

Tyvek was not a natural fiber, but it was necessary to wear around the brainpox virus or you would get infected pretty quickly. He had been around brainpox for a long time and had never become infected. He was careful. He had also come to believe that he might very well be one of the people who, for some reason, were less susceptible to infection by brainpox. He put on double latex rubber gloves, a head covering, surgical booties, and a full-face respirator mask. Then he opened the door to Level 3.

He entered the bedroom and shut the door behind him.

His weapons lab was a comfortable working environment. There were some old Formica tables he had bought at a flea market. It was the flea market where he had traded the box to the woman who had tried to cheat him. He had enlisted her in the human experimental trials. Afterward, he had scanned the newspapers and watched the television news, but nothing about her was mentioned. Also in his lab there was a bioreactor, which was humming away softly, and the virus-drying trays, and the insectary.

The laboratory was situated in the back of his building. He had installed an air-filter system, a quiet little fan, set in a window. It had a HEPA filter. It pulled air out of the Level 3 laboratory, passed it through filters, and discharged it outdoors, clean and safe. This created negative air pressure inside his lab, so that no infective particles would escape. Air was drawn into the lab through a little vent in another window. He had sealed the windows with tape. Nothing fancy, but it worked.

The insectary, which sat on a table, was a colony of moths. He kept the colony for philosophic reasons; he didn't really need it to carry out his work. But it was fun. The insectary was a collection of clear plastic boxes where his moths lived. He pulled open the lid of a box and inspected the green caterpillars inside. He dropped in some pieces of lettuce. They ate vegetables. He had planted a few alfalfa plants in the garden next to his building for them to eat; no one even seemed to notice.

The natural strain of his brainpox virus lived in moths and butterflies. The moth caterpillars crawled around in the boxes eating leaves. They ate until they died. They became paralyzed with the insect strain of his brainpox virus — not the human strain; human brainpox wouldn't grow in insects. The moth caterpillars became listless, but they kept eating. Then, suddenly, the melt occurred. It was a technical term for a virus-triggered meltdown of a creature. It happened in an explosive final wave of virus replication, and in less than two hours the caterpillar was transformed into mostly virus. He understood that pretty much the same type of virus amplification melted the human brain.

He reached inside the insectary and pulled a dead caterpillar off a leaf. The dead caterpillar had turned into a liquid bag full of glassy, milky ooze. It was 40 percent pure virus crystals by dry weight. It was almost half virus. He squeezed the dead caterpillar and the crystalline ooze popped out of it. This melt was a fascinating thing to see. The transformational power of a virus never failed to impress him, even when it worked inside caterpillars.

It was interesting to see how the virus could turn an insect into a bag of virus crystals. The virus could take over its host and keep the host alive — still hungry, still feeding — even while it converted the host's body almost entirely to virus crystals. The virus also stopped the molting process of the insect, so that it never became an adult. It stayed young and ate and ate until it was nothing but crystals. The human strain of the virus could transform the human brain into a bag of virus crystals and make the human eat and eat and eat.

The human species is hungrier than a hungry insect. With its monstrous, out-of-control appetite, it is ruining the earth, he said to himself. When a species overruns its natural habitat, it devours its available resources. It becomes weakened, vulnerable to infectious outbreaks. A sudden emergence of a deadly pathogen, an infectious killer, reduces the species back to a sustainable level. These mass dyings happen all the time in nature. For example, gypsy moth caterpillars sometimes overrun forests in the northeastern part of the United States; they eat the leaves off the trees. Eventually the population of caterpillars becomes so large that the caterpillars use up their food supply, and then all kinds of viruses break out among the caterpillars. Sooner or later some virus crashes the population of gypsy moths, and for years afterward the trees are relatively free of caterpillars. Viruses play an important role in nature: they keep populations in check.

Now consider man, he thought.

Look at the AIDS virus. People go on talking about the depletion of the population because of AIDS, saying what a disaster it is, yet in the next breath they talk about how the environment is being damaged by overpopulation. The fact is that AIDS is an example of the kind of disease corrective that always appears when a population booms out of control. It is necessary. The real problem is that AIDS has not done its work well enough. And what's worse, public health doctors are trying to develop a vaccine for it. ,

There is no more dangerous human being than a public health doctor, he thought. Public health doctors are largely responsible for the uncontrolled boom in the human population that is destroying the earth. The public health doctors are environmental criminals of the highest degree. Even now they are trying to cause an extinction of a natural species, the extinction of the smallpox virus. Smallpox is a beautiful white tiger, and it has a place in nature. Who are we to presume to destroy a white tiger? The Sierra Club and Friends of the Earth should defend smallpox!

Natural thinning events are positive. History shows what I mean, he liked to point out in his mind. In the year 1348 or thereabouts, the Black Death, an infective airborne bacterial organism called Yersinia pestis, wiped out at least a third of the population of Europe. It was a very good thing for Europe. The survivors prospered. They inherited more land and more property. A great economic boom followed the Black Death, and it culminated in the Renaissance. In the wake of the mass dying, the survivors were richer and had more to eat. There were fewer poor people crowded into the towns, because so many of the poor had died. With the numbers of poor reduced, a labor shortage developed in the towns during the years following the Black Death. New machines and new manufacturing processes were invented to make up for the loss of unskilled laborers. This led to increasingly free capital flow. It led to the creation of the first true investment banks, in Florence and in other cities, and great wealth was created, great art, new ideas. One could say that the ceiling of the Sistine Chapel came out of the Black Death.

Historians describe the Black Death as something that just 'occurred' at the end of the Middle Ages. They don't make the connection: the Black Death did. not just 'occur'; it was the biological event that ended the Middle Ages. And the world is overdue for another biological event. If it doesn't happen soon, how many species will disappear, how many beautiful tracts of primeval rain forest will vanish forever? If the public health doctors keep up their work, they will practically destroy the world.

Hence the need for a new disease.

Brainpox was beautiful. It was a biological rocket that destroyed the central nervous system. Driven by its rocketing proteins, brainpox raced along nerve fibers in the skull. Brainpox transformed the brain into a virus bioreactor. The brain went hot. Brainpox melted the brain in the same way that the natural form of the virus melted insects.

The brain bioreactor went hot, and it filled up with virus particles until it melted down inside the skull. The reactor began leaking fluids and biting and thrashing and hemorrhaging and generally running out of control, spreading the virus around to other hosts in a messy but effective way. Of course brainpox caused human suffering, but it was over soon. None of this lingering, as with AIDS, no time for public health doctors to find a cure. Brainpox wouldn't harm any other life forms on the planet, because brainpox infects only the human species. It wouldn't affect the ecosystems and habitats of the rain forest.

He imagined brainpox turning New York City into a hot bioreactor, a simmering cauldron of amplifying virus. From there brainpox would amplify itself outward along invisible lines, following airline routes, spanning the globe. New York was the seed bioreactor, the cooker that would start the other cities going. This was not exactly the revenge of the rain forest; this was the revenge of molecular biology. From New York, brainpox would rocket to London and Tokyo, and it would fly to Lagos, Nigeria, and it would land in Shanghai and Sipgapore, and it would amplify through Calcutta, and it would get to Sao Paulo and Mexico City and Dacca in Bangladesh and Djakarta in Indonesia and all the great supercities of the earth. The cities would go hot, for a while. But it would not be the end of the human species, not in the least. It would merely remove one out of every two persons; or perhaps one out of three persons might vanish. Maybe even less. He didn't know exactly. A biological weapon never exterminates a population. It merely thins. The greater the thinning, the healthier the effect on the species that has been thinned.

He checked on the bioreactor. It was a microreactor called a Biozan. It was running smoothly, the pumps humming gently, making about as much noise as a fishtank. It was making concentrated brainpox virus. The output liquid, saturated with virus particles, ran through a flexible tube to a jar on the floor. As the liquid settled, a white sludge would form on the bottom of the jar. That sludge was mostly virus. He would pour off the liquid from the jar, and the sludge that remained was incredibly concentrated brainpox. He scraped it out with a spoon. It was unbelievable how one little bioreactor could make so much virus.

Near the bioreactor stood the drying trays. He mixed the virus sludge with a special kind of glass in liquid form. It was rather like making candy. He poured the molten glass into the trays. It dried and hardened into coin-sized hexagons of viral glass.

He bought the viral glass mix through the mail. It was great stuff. A little pricey, but it seemed to work. With his double-gloved fingertips, he gently picked up a glass hexagon. He enjoyed holding viral glass in his fingers. He could see the rainbow colors of his virus — His thoughtful reverie was interrupted by a squeaking sound, a dry, metallic squeal. He heard voices and then a crash.

He put the crystal back in the tray. Those kids were being disruptive again.

He pulled back the metal curtain an inch and looked down. His laboratory overlooked an empty lot that was surrounded by a chain-link fence. People in the neighborhood had planted a garden there, with flowers and shrubs (and a little bit of alfalfa, which he had planted).

They had put in an old swing set and a children's slide and a small rotating merry-go-round. It was made of metal. The large boys were standing on the merry-goround, pushing it, shouting. They were making it go too fast, and it was squealing again. They were ten or twelve years old, rough-looking city kids. One of them hurled a rock into the fence. Then the rest of them jumped off and went running, throwing rocks.

At a cat!

It was a brown and white stray cat, one of the animals that people left tins of food for in the informal park below his window. The cat leaped up the fence, but a rock crashed into the fence, and the cat went to the ground and shot off, more rocks pounding around it, and it twisted and screeched when a rock hit it. And then it ran through a hole under the fence, and escaped.

It made him angry, but there was nothing he could do, because he was stuck in Level 3.

Samples

The city morgue truck was backed in behind the Coast Guard hospital, its rear end facing a hospital loading dock. Inside the truck was a bank of refrigerated crypts. There was also a mortuary gurney on wheels — a pan. The bodies of Peter Talides, Glenn Dudley, and Ben Kly were triple-bagged in white body pouches that were plastered with biohazard symbols. The morgue attendants at the O.C.M.E. had splashed large amounts of bleach inside the pouches and around the bodies, to kill the hot agent on the exterior of the bodies.

Lex Nathanson and Austen suited up in a storage room near the loading dock, a room that Littleberry had designated the autopsy decon room. They wore chainmail gloves on both hands. When they got in the truck, they started with Glenn Dudley.

Without removing Dudley from the biohazard pouches, they lifted him by his shoulders and feet out of a crypt. It was a struggle. He was a heavy, muscular man. They transferred his bagged cadaver to the gurney. Nathanson unzipped the bags but did not remove the body. This was going to be a minimal autopsy in a biohazard shroud. Dudley's blood and fluids would collect inside the shroud, and would not flow anywhere else.

No one had removed Dudley's clothing. He was wearing surgical scrubs. His scalp hung down over his face, exposing the dome of the skull. Dudley had prepared his cranium for opening.

Austen lifted up the scalp, and Dudley's eyes came into view. They had developed gold rings in the irises, with flamelike offshoots. She opened his mouth and looked carefully. She found a half-dozen blood blisters, mainly inside the upper cheeks.

Austen cut his scrubs off with blunt scissors, laying the shirt back, opening the trousers.

'I spoke with Glenn's wife,' Nathanson said. 'They have three children. The oldest is fifteen. It's the children I think about.'

'Do they know what happened?' Austen asked him. 'I believe she has told them something but not all of it.' He did the Y incision on Dudley's chest and abdomen, and opened up his chest. He cut Dudley's ribs with loppers, and removed the sternum plate. He remained ice-calm. Austen watched him with respect. She saw no external sign of emotion.

'Do you want me to take over, Dr Nathanson?' 'I'm all right.'

The two pathologists worked carefully. Nathanson did not remove any of Dudley's organ blocks. He and Austen examined the organs in place in his body cavity, and they took biosamples. Removing the organs and sectioning them would splash around a great deal of blood and fluid, and Nathanson felt that the safety risk did not justify the procedure.

Nathanson wrapped Dudley's head in a clear plastic bag. He plugged in a Stryker saw, then put the saw inside the bag, and tightened the bag with a string around Dudley's throat. The bag would prevent blood and bone dust from flying into the air; it would splash inside the bag. This was standard procedure for opening a biohazardous brain.

The saw chattered away, spewing wet bone dust and bloody material on the inside of the bag until the top of the skull could be removed. Nathanson's mask was now completely misted with sweat. Austen watched him carefully. He appeared to be holding himself under tight but fragile control, but suddenly he said, 'Would you take over now, Dr Austen?'

She nodded. She snipped open the dura mater — the gray leathery membrane that covers the brain. Dudley's brain resembled that of Kate Moran: glassy, jellylike, swollen, bloated.

'I splashed a drop of blood in his eyes. It was my fault.' 'Put that out of your mind forever,' Nathanson said. What she could not put out of her mind was her last sight of Ben Kly alive. Kly had given her a chance to escape, and he had done it knowing it might well cost him his life. He had also accompanied her and protected her in the tunnel under Houston Street. He was a city morgue attendant, one of the anonymous handlers of the dead, yet she saw him as a man of perfect courage. The investigation had turned on his help. He left a wife and a small child. Austen felt the unworthiness of a survivor. She could hear Dudley's voice saying, 'You work around it.'

She removed Glenn Dudley's brain, taking great care with the scalpel, cutting the nerves. The brain spread out on the cutting board. It resembled a silvery bag of jelly. The color amazed her. She touched the brain with her fingertips. Protected by the chain-mail gloves, her fingers didn't register the subtleties of the texture, but the brain almost melted under her touch.

With a scalpel, she took small chunks of the underside of the brain and tucked them into biosample jars. 'I'm going to take his eye, Dr Nathanson,' she said. He nodded.

Using a forceps and scalpel, she lifted Dudley's eyelid and chipped and cut bone around the orbit of his right eye. Eventually she freed up the eyeball and lifted it out of the socket. A bit of optic nerve dangled from it. She put it in the stock jar.

Austen made triple sets of samples. One set was for Walter Mellis to carry back to the Level 4 hot labs at the C.D.C.; one was for USAMRIID, at Fort Detrick; and the third set was for Reachdeep.

When they had finished collecting samples and the postautopsy cadavers were back in the crypts in their bags, the two pathologists exited from the morgue truck and went into the autopsy decon room, where they sprayed their suits down with bleach, using hand-pump sprayers. Mark Littleberry supervised the deconning process. They disposed of their suits in biohazard bags. Then Dr Nathanson returned to the O.C.M.E. by helicopter. The autopsied bodies of Peter Talides and Glenn Dudley would have to remain in the refrigerated truck for the time being. They could not be given burial or cremation. They had become federal evidence. The murder weapon was inside their bodies.

Alice Austen carried a box of sample jars containing tissue from the autopsies into the Reachdeep laboratory area. She entered the Level 2 decon vestibule, where she had to suit up again before proceeding inward. She put on a black biohazard suit, marked with the letters F.B.I. She put on lightweight rubber boots and double rubber gloves, and a Racal hood over her head, and then she pushed through a door into the Evidence Core. Hopkins and Lesdiu were bent over the two cobra boxes, which sat on a table under bright lights. Both men wore F.B.I. space suits.

Austen's sample jars contained fresh brain tissue, liver tissue, spinal fluid, vitreous humor from the eye, and blood. She gave the samples to Suzanne Tanaka, who took them into the biology room for culturing, and for examination in the electron microscope. Austen went with her.

Tanaka wanted to try to make the virus grow in flasks of living cells. If she could get it to grow, then it could be studied more easily. Using a simple mortar and pestle, she mashed up a bit of Glenn Dudley's brain and dropped the mush into a series of plastic flasks containing living human cells. The flasks were used for growing viruses in culture. The virus in Dudley's brain tissue might infect the cells in the culture, and the virus would multiply in the cells, until the flask was enriched with virus particles. Then she could put a sample of it in an electron microscope and see the particles. The shape and structure of the particles might help identify the virus.

Nearby, Tanaka had some clear plastic boxes that held white laboratory mice. She made a water preparation of Dudley's brain tissue and injected it into several mice. 'This is our mouse biodetector system,' she explained to Austen. Mice are used in virus labs somewhat like canaries in a coal mine. When you are trying to identify a virus, you may want to inject it into mice. If the mice get sick, you can observe the signs, and then examine the mice by necropsy (that is, kill the mice, cut them up, and look at the mouse tissue through a microscope). 'We'll see if they get sick,' Tanaka said.

Next, Tanaka prepared some samples for the electron microscope. She wanted to try to make a direct image of the virus particles in Glenn Dudley's brain. Working with a scalpel, she cut away tiny bits of brain tissue. Her cuts made samples of brain the size of pinheads. She put the samples into small test tubes and filled the tubes up with a fast-drying plastic resin. The resin would penetrate the brain sample and harden it. Then Tanaka could make slices of it.

She also wanted to look at the powder in the cobra boxes. She went into the materials room, where Hopkins and Lesdiu were still examining the boxes, and, with a fine pair of tweezers, she obtained a small amount of dust from the Zecker-Moran box, which she dropped into a tiny plastic sample tube. She poured quick-drying resin into the tube.

All of the samples — brain tissue and dust — became fixed in a hard plastic resin. Now she had some small cylinders of resin. She cut the resin blocks with a diamond-bladed slicing machine known as a microtome. A microtome is somewhat like a deli's meat-slicing machine, except that the blade is a diamond and the slices it makes are the size of the head of a common household ant. While she worked, she explained to Austen what she was doing.

'Investigations like this get me really fired up,' she said. 'I can hardly sleep when we're on a big case.' 'Have you been on big cases before?' Austen asked her. There was a little pause. 'Well,' Tanaka said, 'not really. I've… dreamed about this, Alice. It feels like what I've wanted to do all my life.'

Tanaka placed the slices on copper sample screens that were the size of this letter o. 'Do you want to look with me, Dr Austen?'

'Yes.'

'Let's look at the Cobra dust first,' Tanaka said. She dropped a copper-screen sample into a sample holder, a kind of steel rod. She slid the holder into the electron microscope, and it made a clinking sound as it locked into place. She threw some switches, adjusted a dial, and a screen glowed. Tanaka dimmed the lights in the imaging room so that they could see the images on the screen more clearly.

In the materials room, Hopkins performed a delicate operation. With a fine pair of tweezers and a hand-held magnifying glass, he took a nearly invisible pinch of dust out of the Zecker-Moran cobra box. He had a hard time seeing what he was doing — his Racal hood interfered with the view. He dropped the dust into a plastic test tube that contained a few drops of salt water and a disinfectant. The tube was about the size of a circus peanut.

Two rooms down, in the darkened imaging room of the Evidence Core, Tanaka and Austen looked into the screen of the electron microscope. Before their eyes hovered an image of the dust particles in the cobra box. Tanaka spun the dials, and the image moved sideways. She was scanning. 'This is weird,' she said. The particles were angular crystals. They had slightly rounded sides, rather like angular soccer balls.

'That's not a virus,' Austen said. 'There's no way it could be a virus. The crystals are way too large to be a virus.'

Tanaka found something inside a crystal. She zoomed the image, moving into the field.

'Look, Alice. Look at that.'

There were dark rods of material inside the crystals. The rods were scattered about. In places they formed bundles.

Tanaka pointed to a bundle of rods. 'Those — I'd bet those are the virus particles themselves. They're surrounded by these crystals. You've got virus particles embedded in crystals.'

'What do you think the crystals are made of?' Austen asked.

'I don't know. They appear to be a protective coating around the virus particles — if those little rods inside the crystals are virus, which I think they are.'

Tanaka put another sample in the electron microscope. 'We're looking inside one of Dr Dudley's brain cells,' she said. She spoke of his cells in a personal way,

as if she might be speaking of a hand or an arm. The crystals inside the cells were chunks of material sitting in the cell's nucleus. Some of the crystals were cracking open and seemed to be releasing particles into the cell's cytoplasm, the cell's interior. The particles resembled rods or batons. In places, Tanaka found the rods floating around inside a brain cell without any crystal material near them.

'Dr Dudley's brain cells are a mess,' Tanaka said to Austen in a low voice. 'This is as bad as Ebola.' 'Have you seen Ebola?' Austen asked.

'Sure. Part of our training. This isn't Ebola.' 'Do you think you know what it is?'

'I'm not ready to say, Alice. I think I know.'

Austen was standing behind her, looking down at the screen. She felt dizzy, as if she were falling into the depths of a microscopic universe that extended inward to infinity.

'I have to be careful here,' Tanaka went on. 'There is a type of virus that makes crystals like this. It lives in butterflies and moths.'

'It lives in butterflies?' 'Yup,' Tanaka said.

Tanaka had brought reference textbooks with her. When you are looking at virus particles in a microscope, trying to make a visual identification of the virus, you check the images against photographs in a book, in the same way that a bird-watcher might look up photographs of birds in an Audubon field guide.

Tanaka went over to a military transport box sitting in a corner of the imaging room. She threw the catches, and pulled out a textbook on viruses. She closed the box and sat down on it, and opened the volume on her lap. Austen sat beside her. Tanaka flipped through the table of contents, then turned to a page about halfway into the book. 'There,' she said, putting her finger on a photograph.

She had come to a section on insect viruses. The photograph showed images of crystals.

'This is nuclear polyhedrosis virus,' Tanaka said to Austen. 'That's kind of a mouthful. Let's call it N.P.V. You know, like H.I.V.? This is N.P.V. This virus scares the hell out of me.'

Austen saw that Tanaka wasn't kidding when she said the virus frightened her. Tanaka's breathing hood had misted up, a sure sign of upset. 'The crystals are a kind of protein, I think,' Tanaka said, her voice not strong. She said that the virus particles were clumped inside the crystals. 'The crystals are like — kind of — protective shells around the virus. They protect the virus from harm. This thing is an engineered weapon, Alice.'

Tanaka returned to the microscope and began snapping photographs with an electronic camera that was attached to it. Image by image, huge crystals appeared on a video screen. The two women looked at cells from the golden areas in Dudley's irises. The cells were full of crystals. It was the crystals, forming in the pupillary ring around the iris, that gave the eyes the yellow-gold color. There were crystals in the optic nerve leading to the eye. The virus had either migrated through the eyes into the brain along the optic nerve, or it had spread out of the brain to the eyes.

They were seeing a life-form that Austen.had seen earlier through the optical microscope in Glenn Dudley's office, when she had first looked at Kate Moran's brain tissue in a microscope. Then she had seen fuzzy shapes, without much clarity. Here, the clarity was superb, and the crystals loomed like planets.

'We have to tell Will,' Tanaka said.

The Code

Will Hopkins, now dressed in surgical scrubs but not a space suit, had set up a work area on a table in the conference room. While Tanaka was attempting to make an image of the virus particles, he would try to 'see' the DNA of the virus using his machines. In this way, he hoped to get a rapid identification of the virus.

He hooked up the two Felix machines on the table. He deployed several other small machines as well. He also put out a bagel with cream cheese, which he munched while he worked. Wires and cables trailed everywhere.

Hopkins had a sample of Cobra dust in a small plastic test tube the size of a baby's finger. The dust had been sterilized with chemicals and mixed with a few drops of water. It wasn't dangerous. It contained a quantity of DNA from the virus. He held the tube up to a bright light and swirled it around. Sometimes you could actually see DNA with your naked eye — it formed milky lumps in a test tube. This time, he couldn't see any, but the water in the test tube was nevertheless full of strands of DNA, like a soup made with angel hair pasta. He put a droplet of the water (containing DNA from the virus) directly into a sampling port in one of the Felix machines.

Felix began reading the DNA, but nothing came up on the screen. Felix was having some problems. Hopkins had to resist a temptation to bang Felix with his hand, the way you'd bang a television that isn't working. Just then Austen and Tanaka came in. Tanaka's face was radiant, she was beaming, but holding back.

'I'm having trouble getting gene sequences here,' Hopkins said to them.

'Take a look at this,' Tanaka said. She laid the photographs in front of Hopkins.

'Whoa,' he said. He stared at the photographs, chewing bagel.

'These are particles we recovered from Glenn Dudley's brain,' Suzanne Tanaka said.

'Midbrain. The part of the brain that controls primitive behavior, such as chewing,' Austen added.

'Look at the crystals, Will,' Suzanne Tanaka said. 'See that blocky shape? This looks like the nuclear polyhedrosis virus. N.P.V., which lives in butterflies. It isn't supposed to live in people.'

Hopkins stood up slowly, a look of wonder on his face. 'It lives in people now,' he said. 'My God, Suzanne! A butterfly virus. This is great!' He slapped her on the back. 'Suzanne, you are the best!'

She looked very pleased. She didn't say anything. 'All right!' Hopkins said. 'All right.' Now he paced the room. He ran his hands over his face. 'All right. What are we gonna do, guys? Are we going to tell Frank Masaccio we've got a butterfly virus? He won't believe us. He'll think we've gone lunatic.'

In biology, the shape of an organism may not tell you how it fits into the evolutionary tree of life. Many viruses look alike in a photoscope but are very different at the genetic level. 'We need some genes,' Hopkins said. 'We need a gene fingerprint. Felix is gonna prove this thing is a butterfly virus. I'm scanning genes already, but I haven't put it together.'

He bent over the Felix machine, his hands flying, working like a madman.

Austen found herself watching Hopkins's hands as he worked. His hands were muscular, but they were gentle and precise in their motions. There was no trembling, no hesitation, no spare or useless movement. His hands were in perfect control. These were trained hands, the hands of a gadgeteer. 'I'm purging the system. We'll try again.'

Using a micropipette, he put another sample of DNA into Felix. Still standing, he tapped the computer keys, and letters of text began to appear.

This was genetic code from somewhere in the DNA of the Cobra virus.

Molecules of DNA resemble a spiral ladder. The rungs of the ladder are known as the nucleotide bases. There are four types of bases, and they are denoted by the letters A, T, C, and G. (The letters stand for adenine, thymine, cytosine, and guanine — nucleic acids.) The length of the DNA in living creatures varies greatly. Human DNA consists of about three billion bases. That's enough information to fill three Encyclopaedia Britannicas. All of this information is crammed into every cell in the human body. A small virus, such as the virus for the common cold, has only about 7,000 bases of DNA. Hopkins had made a guess that the Cobra was complicated and would probably contain around 50,000 to 200,000 bases of DNA.

Sometimes as few as a dozen bases of DNA code are enough to provide a unique fingerprint to a particular organism. You can use a computer program to match unknown code with known code. If you can make a match, then you can identify the organism the DNA came from. The process of matching unknown DNA code with known code is like the process of opening an unread book and reading a few lines from it. If the lines are familiar, then you can make a guess as to the book. For example, these words serve to identify a book: In the beginning God created the heaven and the earth. And the earth was without form, and void. The exact edition of the book (the 'strain' of the book, so to speak) is the King James translation of the Bible in English.

As strings of letters marched across the screen, Hopkins hoped that he would soon have a better idea of what kind of book Cobra was.

The letters drifted in blocks across the screen. 'Time to get on the Web,' Hopkins announced. He ran Netscape on one of the Felix laptops. His computer then socketed into the World Wide Web via the satellite dish sitting on the patio deck. In a few seconds, he arrived at a Web site known as GenBank. This site — it is in Bethesda, Maryland — has a huge database of genetic sequences. GenBank is the world's central library of genetic codes.

Hopkins clicked a button on the screen. The GenBank computer looked at the code and began matching it to known genetic codes. Soon an answer came back:

Sequences producing High-scoring Segment Pairs:

It was a list of virus DNA codes that had shown close matches with the code that Hopkins had sent. The top line showed the closest match.

'Looks like we've got a rough identification of the Cobra virus,' Hopkins said. 'That top line, right there, that's the probable strain of the virus. That's the closest match to Cobra.' His finger traced over

Autographa californica nuclear polyhedrosis virus Cobra virus was similar to the nuclear polyhedrosis virus, or N.P.V. (It is also called the baculovirus.) This particular strain lived in a moth. The moth was Autographa calijbmica, a small brown and white moth that lives in North America. The caterpillar of the moth is a crop pest, a green inchworm known as the alfalfa looper. The virus invades the moth caterpillar and kills it. Cobra was based on a moth virus, but it had been altered.

N.P.V. is a common virus used in biotechnology labs all over the world. It is available to anyone, and Hopkins's heart sank as he thought about this. The virus was going to be devilishly hard to trace back to its original source. It made him wonder if his idea of a Reachdeep operation was already in trouble.

The crystals that Tanaka had photographed were actually crystals of protein, with virus particles embedded in them, like seeds in a watermelon. The protein is called polyhedrin, because it forms rounded crystals that look like soccer balls: polyhedrons.

The genes of N.P.V. can be changed easily without causing harm to the virus. Many viruses are difficult to change. They are too sensitive. If you change their cross section through a crystal of Autographa californica nuclear polyhedrosis virus. Magnification 25,000 (Electron micrograph courtesy of Dr Malcolm J. Fraser, Jr, and William Archer, Department of Biological Sciences, University of Notre Dame.) genes, they stop working. But N.P.V. is a rugged, tough, flexible virus. It can be given foreign genes that change its behavior as an infectious agent. Hopkins knew enough about viruses to know this, and it chilled his blood to make the identification. He knew that buried somewhere in the code of the Cobra virus he would find engineered genes. Genes that had been put there, enabling the virus to replicate in human tissue, specifically in the central nervous system.

Cobra was a recombinant virus, or a chimera. In Greek mythology, the chimera was a monster.with a lion's head, a goat's body, and a dragon's tail. 'The chimera,' Hopkins whispered, 'was a tough monster to kill.'

He put a few more drops of sample liquid into Felix and started Felix on another run, pulling up more DNA code. Austen had finished her autopsies, and for the moment she did not have work to do. She suited up and went back into the Core to see what was going on there. Suzanne Tanaka went back to work with her microscope.

Signatures

In the Core, James Lesdiu was running a forensic analysis of the physical materials used in constructing the two boxes. They were bombs. All bombs, as Hopkins had so passionately maintained at the SIOC meeting, contain forensic signatures that can guide an investigator to the builder of the bomb.

Austen found Lesdiu sitting at a table in the center of the materials room, the cobra boxes before him under bright lights. He was holding an old-fashioned magnifying glass in one hand and a pair of tweezers in the other. His hands were enormous. They were covered with double rubber gloves.

'I'm dying inside this suit,' he confessed to Austen. He was dressed in an extra-large F.B.I. biohazard suit, and he looked extremely uncomfortable. His Racal hood was beaded with sweat on the inside. He had draped a towel over his shoulder — inside his hood. Now he shifted his shoulder, turned his head, and wiped the sweat off his face using the towel.

Lesdiu probed the tweezers here and there in one of the boxes.

'I'm looking for hair-and-fiber evidence,' he explained. Lesdiu plucked at something inside the box. 'There's another hair. It's another Q.'

Austen had never heard the term Q.

Lesdiu explained that he had found some unknown human hairs. 'They're questioned hairs,' he said. 'We call unknown samples Q evidence, or questioned evidence. It's questioned because you don't know what it is or where it comes from.' He had placed the hairs on a sheet of brown paper. 'Samples are either questioned samples or known samples. The questioned samples are things that are found at the crime scene. Sherlock Holmes called them clues.' He smiled. 'Os are physical evidence. We analyze the 0 samples, hoping to match them with something known. Forensic science is largely pattern recognition. The Os are things like fingerprints, hair and fibers, blood, toolmarks, shoe prints, all kinds of trace evidence. DNA is trace evidence. The DNA of the Cobra virus that you've been looking at on the screens, that's a questioned sample, because we don't know where the Cobra virus comes from.'

Austen realized that this was very similar to what she had been doing in the beginning, when she had traced the outbreak to the boxes. 'You guys are doing a diagnosis of a crime.'

'In a way, yeah,' Lesdiu said.

The F.B.I. maintains enormous reference collections of known samples of all kinds of objects. These are called reference knowns. 'If you can match a fingerprint, you can get a conviction,' Lesdiu said. 'Because a fingerprint pattern is unique. But forensic evidence is not always so clear. That's why you usually need a lot of it.'

Lesdiu put his tweezers down. He was taking a break. 'I've got two hairs so far,' he said. They come from the Zecker-Moran box. One is a fine, reddish hair, with an oval shaft, Caucasian.'

'That sounds like Kate's hair,' Austen said.

'It probably is,' Lesdiu said. 'Frank Masaccio's folks are getting some known hair samples from her bedroom. As soon as they arrive, I can start comparing Qs and Ks. The other hair is oval and transparent. It's a gray hair from a Caucasian.'

'Penny Zecker' Austen said.

'Maybe. We'll be getting hair samples from her house too. I also found some wool fibers. Black. Maybe from a sweater — maybe the girl's sweater, maybe not. The other box, the one the homeless guy carried around with him — ' Lesdiu indicated the Harmonica Man box, which was sitting beside the Zecker-Moran box. 'This one has a ton of fibers all over it and in the cracks. The fibers are cotton and polyester. The box was wrapped up in the guy's clothes. I have to say that anyone who was smart enough to load this box with a virus is smart enough not to leave any hair or fibers on it. This fiber analysis is not going to pan out. My bones are telling me that. But there's more than one way to skin a cat. There's a ton of microscopic evidence in these boxes.'

Jimmy Lesdiu had set up a row of machines in the materials room. One of them could throw a beam of infrared laser light on an object and then analyze the spectrum of the light bouncing off the object. The machine gave information about what the sample was made of. It could also see invisible fingerprints on a surface. Lesdiu had also set up a machine that could vaporize a sample and identify the atoms in the gas coming out of the sample.

Lesdiu found a number of fingerprints on the boxes. He photographed them in laser light and sent the images by satellite to Washington, where the fingerprints would be analyzed. Later, it would turn out that none of the fingerprints belonged to the Unsub. They belonged to Kate Moran and Penny Zecker. The Unsub had been much too careful to leave fingerprints.

A shiny black enamel had been used to paint the design on the box. With the infrared laser, Lesdiu got a spectrum of colors from the paint. To the human eye, the paint was black, but to the laser it was a rainbow of colors. Lesdiu passed the paint spectrum on to Washington, and within minutes an F.B.I. expert in paint called him back on the telephone. The call came into the hot Core on a speakerphone, since you can't use a telephone handset if you are wearing a Racal hood.

'You folks in Forensics must be standing around waiting for me to call,' Lesdiu shouted on the speakerphone to his paint expert.

'We've been told to respond quickly. Frank Masaccio will kill us if we don't.' The paint expert went on to say that the paint was a common enamel model paint. It was sold in hobby shops everywhere.

The signature had petered out into a maze of common objects. This was typical of signatures. Still, the paint was a Q that could be tied to a K, if a suspect turned up with enamel model paint.

The cobra boxes had bits of paper glued to them, on which words were written — Archimedes' name and the date. The bits of paper were glued to the box with a clear, flexible glue. With a razor blade, Lesdiu cut away a tiny shred of the glue. 'It's kind of a rubbery glue,' he said. 'I'd say it's a silicone glue or a hot-melt type of glue.'

He dropped a bit of the glue from the knife onto a glass slide, ran it through the laser machine, and got some data. 'I got a real nice infrared spectrum of this glue. Look at that, isn't that beautiful?' he said.

Alice Austen stared at the screen. It was a meaningless jagged line to her. She told Jimmy Lesdiu as much. 'There's information in these peaks and valleys,' he said.

'If you looked at a cell, you wouldn't see much in it,' she said to him. 'I would see a world.'

There was a man at F.B.I. headquarters who could see a world in a drop of glue. They called him the Maven of

Glue. James Lesdiu sent the spectrum of the glue over an encrypted satellite link to the F.B.I. forensic lab at headquarters in Washington, meanwhile talking on his speakerphone to the scientist known as the Maven of Glue. The Maven put Lesdiu on hold for a few minutes, and then said to him, 'Okay, Jimmy, I've checked the spectrum against our library of adhesives. You are not going to be happy, Jimmy.'

'I'm listening,' Lesdiu said, standing by the speakerphone.

'The spectrum you sent is consistent with a silicone glue made by the Forkin Chemical Company in Torrance, California. It's called Dabber Glue. They sell millions of tubes of this stuff. You can buy it in any hardware store. I really like it. It's a nifty glue. I use it myself at home.'

Austen said, 'Why doesn't somebody call Forkin Chemical?'

Lesdiu shrugged. 'That would probably be useless. They can't trace millions of tubes.' Nevertheless, he called Frank Masaccio with the information, and an F.B.I. agent got in touch with the president of Forkin Chemical. The agent and the company president had a very pleasant conversation, and the president called an emergency meeting of his technical people and his top sales staff for the northeastern United States. But in the end, there was nothing the management of the company could do to help narrow down the retail source of the glue. The company said that there were at least three hundred retail-outlet stores in the New York area that would be selling Dabber Glue. And of course the Unsub might not have bought the glue in the northeastern United States. The glue was sold everywhere.

Lesdiu held the box in his long fingers, squinting at it. He looked at it with his Sherlock Holmes handmagnifying lens. He found some kind of black, powdery dirt embedded in the glue. Very fine particles of dirt, jet black.

'I'm going to nail this dirt,' Jimmy Lesdiu said.

He had to separate a few particles of dirt from the glue, and silicone does not dissolve in most solvents. But after a further conversation with the Maven of Glue and with chemists at headquarters, Lesdiu came up with a solvent that would work. He rooted in one of the supply boxes, shuffling through bottles, until he found what he was looking for. Then he dissolved a bit of the glue in a small test tube, and swirled the particles. A blackish, brownish haze hung in the liquid. Now he had to separate the particles. He returned to a supply box and found a magnet. He held the magnet against the test tube. The black dust drifted toward the magnet. 'It's a ferromagnetic material. It's iron or steel,' he said. But the brown haze did not move under the magnet. The brown haze was probably an organic material or rock or concrete dust. Lesdiu had separated the dirt into two components — a black dust and a brown haze.

'I've done an autopsy on a terror device,' Lesdiu remarked to Austen.

But now he had reached the end of what was possible with a Reachdeep portable operation. The sample of dust had to go to the F.B.I. metallurgists in Washington, who would continue the analysis. Into the test tube of dust he dropped a strong disinfectant — to sterilize the contents, just in case it contained any live Cobra virus particles. A few minutes later, a Bell turbo helicopter took off for Washington bearing the test tube. The team would have to wait several hours, at least, before the F.B.I. metallurgists could tell what the black dust was. The particles might contain information, but whether that information would constitute a signature that could lead back to the perpetrator, no one knew.

The only part of the boxes not yet studied was the wooden material of the box itself. James Lesdiu pondered it. He didn't recognize the type of wood. He didn't recognize the design and style of the box, either. It was clearly handmade, and Lesdiu guessed that either Archimedes had made the box himself or that he had bought it at a trinket shop. Reachdeep needed a forensic botanist. Lesdiu called Washington and asked that an expert on wood be flown to Governors Island. Then he photographed the boxes in different kinds of light. He was especially interested in the small pieces of paper that were glued to the boxes. He set up a camera stand and photographed the papers with different kinds of light shining on them. It seemed that the Unsub had been careful to avoid watermarks when cutting the paper. The text itself was from a high-resolution laser printer. The type font was Courier, a common font. While F.B.I. scientists could identify characters from an old-fashioned typewriter, they could not identify laser-printer output. The chemical composition of the paper might lead to a particular manufacturer, but that would probably not be helpful in finding the Unsub.

Every detail of the boxes had been chosen by the Unsub to be hard to trace.

Will Hopkins had set up a series of videoconference meetings with molecular biologists at the Centers for Disease Control and at USAMRIID at Fort Detrick. The experts told him that the Cobra chimera had been built on the most common laboratory strain of baculovirus. It was available through the mail, and it was in use everywhere in the world. The experts told him that they did not know how the virus could be made to replicate explosively in human cells. One of them said to him, 'It's doable. But I just don't know how. The baculovirus is adaptable, and someone's figured out how to adapt it to humans, that's all.'

Mark Littleberry studied James Lesdiu's magnified photographs of the bits of paper glued to the boxes. He was interested in the drawing of a bioreactor that appeared on Harmonica Man's box. He had never seen this exact type of bioreactor before, but in studying the drawing he became convinced that it had been done from life. The drawing had been made by Archimedes using a simple drawing program on a computer, and then it had been shrunk to a tiny size on a laser printer. The drawing was sketchy, but Littleberry believed it had been done by someone who had used a bioreactor and knew exactly how it worked. But who had manufactured the bioreactor? Littleberry and various F.B.I. agents with Masaccio's task force studied sales catalogs and made telephone calls asking about the designs of bioreactors made by companies in the United States. It was not an American design. Littleberry came to suspect — it was a gut feeling, but he couldn't prove it — that the bioreactor came from either an Asian biotechnology company or from perhaps Russia. Tracing it would be very difficult.

The forensic Reachdeep operation was not going as well as Hopkins had hoped. The idea that so many lives might depend on his team's work frightened him. At times he wished he had never joined the F.B.I. Even though he was dog-tired, he found that he couldn't sleep, and he wondered if he was getting an ulcer.

During a discussion of the Unsub's motives, Hopkins suddenly hurried out of the meeting room, and people heard him throwing up in the bathroom. He came out after a while looking shaky. He said that he had been drinking too much coffee. Some of them were afraid he might be getting sick with the virus, but they didn't know what to say or do about it.

'I'm scared for Will,' Littleberry later remarked to Austen. 'I'm wondering if he made promises he can't keep.'

Chimera

Hopkins was thinking about the virus that he and Littleberry had found in Iraq. The drawing of the bioreactor on the cobra box looked somewhat like the bioreactor that he had seen inside the truck in Iraq — at least from what he could remember. The possibility that the deaths in New York were a terrorist event being sponsored by Iraq weighed on him. He discussed it by phone with Frank Masaccio. Masaccio was very disturbed by this. 'If this is terrorism sponsored by a foreign government, Will, this could start a war.'

'I know, Frank,' Hopkins said.

Hopkins put in a call to the Navy's Biological Defense Research Program in Bethesda, where one of his contacts, a Navy doctor named John Letersky, was working through the night. Letersky was a member of the group that supplied Felix equipment to the F.B.I. He had been trying to analyze the chunks of genetic material that Hopkins and Littleberry had beamed up to the satellite when they'd been locked in the rest room.

'Will! How are you doing?' Letersky said.

'The truth is, I'm scared, John. We have a bitch of an investigation that's going nowhere.'

'I'm hearing about it.'

'What can you tell me about the stuff we got in Iraq?' 'It's bad, Will,' Letersky said.

'How bad?'

'Those crystals you swabbed in the truck? Looks like they were Ebola virus crystals. But some of the DNA sequences show similarities to influenza virus. Problem is, you didn't get enough DNA. We don't know what the Iraqis were dicking around with in the truck, except that the virus had Ebola in it, and might also have flu in it.'

Hopkins let out a deep breath. There was no apparent connection between the virus in New York and what he had found in Iraq. This made him feel better, for reasons he could not quite articulate.

'So what's the White House going to do about Ebola in Iraq?' he said.

'Nothing. You heard that off the record, okay? Trying to get the White House to pay attention to bioweapons is like pulling teeth. We'll submit a report to the United Nations, and that's as far as it will go. The Iraqis will claim we made a mistake or we're lying, and the White House will drop it. You guys were way outside the limits. We don't have a real sample. And the truck's long gone.' Hopkins went back to work with the Felix machines, and late in the afternoon he had a breakthrough. The following genetic sequence came up on the screen of one of the Felixes: gaccatattcaggagaaccaaagcccaagac taaaatcccagaaaggcgtgtagtaacacag

It looked no different to Hopkins than any other string of genetic code. The human mind can't read the text of life as easily as it can read Shakespeare. But the GenBank computer could read it. Hopkins got this answer back: Sequences producing High-scoring Segment Pairs:

'Human rhinovirus,' Hopkins muttered. 'Human rhinovirus. The common cold!' He jumped to his feet. 'My God! Cobra's got a piece of the common cold in it!'

He ran to the window of the Core and pounded on the glass. 'Hey, everyone! We've got the common cold!' Hopkins continued picking the genes apart using Felix. He couldn't believe it. It took his breath away. This was impossible. Cobra was partly a common cold. He couldn't figure how it had been mixed with a butterfly virus. It made no sense to him. Somehow the creators of Cobra had managed to make a sticky molecule of some kind on the virus particle that enabled it to grab on to the mucus membranes of the body, especially in the area of the mouth and nose.

'The victims look like they have a cold, when they first get sick,' Austen remarked to him. 'Kate Moran, especially, had a streaming cold.'

'No doubt she felt as if she had a cold,' Hopkins said. 'This bastard of a virus probably attaches itself to the eyelids — cold viruses do that — or to the membranes in the nose. That would explain the design of the cobra box — it blows virus in your face. I just wonder if it's engineered to get into the lungs, too.'

'But how does.it move to the brain?' Austen asked. 'It likes nerves,' he said. 'The optic nerves and the olfactory nerves in the nose are hard-wired straight into the brain, aren't they, Alice?'

She nodded.

'So Cobra hits a mucus membrane and it zooms for the brain,' he said. 'Cobra is a biological missile designed to take out the brain. There's no cure for the common cold. The common cold is very contagious. Cobra is the ultimate head cold.'

One of the two Felix machines beeped. His fingers danced over the keys, and he stared at the screen. 'Yup. Here's another cold gene. It's surrounded by expression cassettes of unknown biologic function. Hm, hello? What's this? Hm.' His fingers clacked away, and genetic code unreeled across the screen, the language of life twisted into a secret poem of death.

Dawn

Alice Austen was assigned a simple Coast Guard officer's room as a bedroom. It overlooked the quiet waters of the bay, where the running lights of container ships flickered in the moving air. The only furniture in the room was a metal folding cot with blankets and sheets. Someone, probably an F.B.I. agent from Masaccio's office, had gone over to Kips Bay, gathered up her personal things, brought them here, and left them sitting on the bed. That vaguely embarrassed her. She turned on her cell phone and debated calling her father, but decided not to. She would wake him up again if she called now. Then she lay back on the bed and looked up at the ceiling. She was too tired to take off her clothes. She began to doze off. Suddenly it was five-thirty in the morning, and the birds were singing in the gray light.

Suzanne Tanaka stayed up most of the night, working alone in the Core. Most of the team had gone off to get some sleep. But she could not sleep. She was too keyed up. She looked at more electron-microscope images for a while, then decided to look at the mice again. It would be too soon to see any symptoms, but you never knew.

She bent over the boxes. They were clear plastic, and the mice were white mice, and they were moving around, because mice are active at night. They seemed fine. Except for one male mouse. He seemed wobbly. She looked at him more closely. He was very active. He was chewing on a wooden nibble block. Chewing and chewing. But mice normally chew a lot: chewing is rodent behavior. She looked at the clock on the table. She had injected the mice with Glenn Dudley's brain material just last night, and now it was the early hours of the morning. That was too little time for a mouse, even with its fast metabolism, to be showing clinical signs of infection by Cobra. And there was no evidence to show that Cobra could infect rodents anyway. Nevertheless, the mouse's chewing behavior bothered her: then again, this was probably her imagination talking to her.

She did not want to make any mistakes. She had begged Will Hopkins to put her in the group. She decided, finally, that she would bleed all the mice — take blood samples from all of them. Maybe the blood would show signs of infection, maybe not.

She went over to a cargo box that held her animal kits, and she got a soft leather glove and some disposable syringes. She pulled the leather glove over her surgical glove. She opened a box and removed the first mouse, holding it in her gloved hand in a practiced way. The mouse struggled.

She placed the needle under the mouse's skin and withdrew a few drops of blood. The mouse was struggling wildly. He's as afraid as I am, in his dim little way, she thought. Just then the mouse flipped out of her gloved hand and landed across her right hand, the one without the leather glove. For just an instant the mouse bit through the latex rubber and hung on with its teeth and let go.

Tanaka gasped and juggled the mouse back into its box.

It was just a nip. For a moment she didn't think the animal had drawn blood. She inspected her rubber glove. Then she saw it: two red dots on her right index finger,

where the mouse's front teeth had penetrated. The slightest smear of blood welled up under the rubber. 'Damn!' she said.

It could not be. Was there any virus circulating in the mouse's bloodstream? We don't even know if Cobra can infect a mouse. Yet she had heard stories of people pricking their fingers in the Army hot tabs. If it was a hot agent, incurable, you had between ten and twenty seconds to remove the finger with a clean scalpel. Otherwise the agent would move down your finger and enter your main blood system, and it could go anywhere. You had a twenty-second window of opportunity to save your life by cutting off your finger.

She dashed over to a cargo box, found a scalpel, stripped it, fitted the blade — quick! — and slammed her hand down on the box. She held the scalpel clumsily with her left hand, poised to slash it down on her finger. And didn't do it. Couldn't.

This is crazy, she told herself. I don't want to lose my finger.

And then the twenty seconds had passed, and the choice was no longer hers to make. She put the scalpel down. Sweat poured from her face. Her Racal hood fogged up, and Tanaka realized that she was weeping.

Stop this, stop this. I'll be all right, she told herself, I'll be all right. This was not an exposure, she told herself. We don't even know if it can live in mice. I'll just have to wait and see, but I know I'll be all right. I will not tell anyone. Because they'll take me off the investigation, and this is my first big case.

Morning

Alice Austen returned to the Reachdeep unit shortly after the sun came up, and she found Suzanne Tanaka sitting in the meeting room drinking coffee. Tanaka looked exhausted.

'You need to get some sleep, Suzanne,' Austen said to her.

'I wish I could.'

Hopkins was talking on the telephone to John Letersky of the Navy's Biological Defense Research Program in Bethesda. It was six o'clock in the morning, and Letersky was still there. 'What I need, John, are some antibody probes for insect nuclear virus. Do you have any probes like that?'

'No way,' Letersky said.

'It would be good if we could program the hand-helds to detect Cobra,' Hopkins said. 'We'd like to be able to test blood and tissue, and we want to do quick environmental sampling for the presence of Cobra.'

A hand-held biosensor device requires special antibody compounds known as probes in order to register the presence of a given hot agent. The probes are molecules that lock onto proteins in the hot agent. They change color as they lock on, and the biosensor device reads the color change.

'I hear you, Will. Let me start calling around. You stick to the investigation.'

Hopkins hung up. 'Whew. Coffee. I need coffee.' 'Did you get any sleep last night?' Austen asked him. 'A couple of hours.' He went over to the electric coffee machine. The pot was empty. 'I need some breakfast,' he said to Austen. 'What about you? Hey, Suzanne! Breakfast?'

'I'm not hungry. I'll eat later.'

Austen and Hopkins caught a helicopter up the East River. It let them off at the East Thirty-fourth Street Heliport. A few minutes later they were sitting in a coffee shop on First Avenue.

'A four-star breakfast, if you add in the airfare,' Hopkins remarked. It was an old-style coffee shop, with a short-order cook flipping eggs behind a stainless-steel counter, and a waitress who went around refilling disposable plastic cups in reusable holders.

Austen took a sip of coffee. She said, 'How did you end up doing this?'

'What, Reachdeep?'

'You don't seem like the type.'

He shrugged. 'My father was in the Bureau.' 'Is he retired now?'

'No. He's dead.' 'I'm sorry,' she said.

'He was a field agent in Los Angeles, where I grew up. He and a partner went to talk with an informant, and they walked into a murder in progress. One of the subjects panicked and opened fire through the door when they knocked. My father was hit in the eye. I was thirteen. I grew up hating the Bureau for taking my father away.'

'But — never mind.'

'You were going to ask me why I joined the Bureau?' She nodded.

'I guess at some point I realized I was a cop, like my father.'

'You're not a cop.'

'I'm a type of cop, and I'm scared this investigation isn't going to work.' He looked at the table and played with a spoon.

'I don't think we've diagnosed the disease yet,' she said. 'The self-cannibalism. We can't explain that.' 'You put an insect virus in a human system, you get a complicated result,' Hopkins said.

The waitress brought over a plate of fried eggs with bacon for Hopkins, and fruit and an English muffin for Austen.

'You need to eat more, Alice,' Hopkins said. 'Bacon is good for you.'

She ignored him. 'If we could just see through the disease, maybe we could see the person who's spreading it.' Her voice trailed off.

'But we do have a diagnosis. It's Cobra.'

'No. We don't. Will, you're looking at the genetic code. I'm looking at the effect of the virus on people. We don't understand Cobra as a disease process. There is no diagnosis.'

'That's a funny idea.' He took a slow sip of coffee, looking dismayed.

She thought: So many details to hold in your mind. If you could fit them together, the pattern would emerge. 'WilL' she said. 'How about the dust in the glue — the dust that James Lesdiu found? I'm wondering if it's steel dust from the subway.'

'Steel dust? What's that?' Hopkins asked. He loaded egg and bacon into his mouth. Traffic went past outside the window.

'Ben Kly showed it to me. It's all over the subway tunnels. Two homeless men have died of Cobra, and they were neighbors living in a subway tunnel. I wonder if Archimedes lives in the subway.'

'Impossible,' Hopkins said. 'You can't do lab work in the subway. A virus lab has to be spotlessly clean, and you need some sophisticated equipment. You just couldn't put that stuff in the subway.'

'If he had any steel dust on his fingertips, he might have spread some of it into the glue when he was making the box.'

'Sure. But a lot of people take the subway, and they probably get dust on their fingers. All the dust shows is that Archimedes took the subway the day he made the box. Big deal.'

'Maybe he's been exploring the subway to look for the best place to do a big release,' she said.

Wanderer

He slept late (by his own standards) and was out of bed by seven o'clock in the morning. First he went into the staging area and suited up in a Tyvek suit and entered Level 3. He checked on the bioreactor. It was running smoothly. It might run for another day or two before he would have to replace the core. He checked on the drying of the viral glass. It had hardened nicely during the night. With double-gloved fingertips he picked out a hexagon, a sliver of brainpox viral glass. He loaded it into a wide-mouthed plastic flask. The flask would fit in his pocket. He screwed a black cap on the flask, and tightened it hard. He dipped the flask in a pan full of bleach and water. That was to sterilize the outside of the flask. The inside of the flask was hot, in a biological sense. The hexagon contained perhaps a quadrillion virus particles.

He went down the stairs and out onto the street. He walked for a while. It was a cool Monday morning, with a high overcast, almost motionless air. He could see a tinge of brown in the sky, a hint of summer's coming smog. It was the right kind of weather for a biological release. You wanted slow-moving air and a weather inversion, with a haze of pollution.

He ended up in Greenwich Village, where he stopped for breakfast at a cafe. He ordered a goat-cheese omelette with fresh-baked sourdough bread and wildflower honey and a cup of coffee. No meat, but today eggs were acceptable. He took the flask out of his pocket and put it on the table next to his food. It looked harmless. Only a bottle wrapped in a plastic bag. If you looked closely at the flask you would see a pane of viral glass sitting inside the bottle. The waiter didn't notice; no one noticed.

He mulled over his possibilities. The question was not just the power of the hot agent, but how it was to be dispersed. The boxes were okay for the Phase I human trials, and it was clear that they worked. The low-key warnings about them that were now being broadcast on TV proved that. Good. It was time to move on.

He reached into the pocket of his windbreaker, which was draped on the back of his chair, and pulled out a photocopy of a scientific report. He placed it beside the flask and unfolded it and smoothed it and put his coffee cup on the paper to hold it there. Then he began to read. 'A Study of the Vulnerability of Subway Passengers in New York City to Covert Action with Biological Agents'he was reading it for about the hundredth time. Department of the Army, Fort Detrick, Maryland. It had been published in 1968.

The study described how Army researchers had filled glass lightbulbs with a dry, powdered bacterial-spore preparation, finer than confectioner's sugar. The particles were in the size range of one to five microns, the lung-friendly particle size. The bacterial agent was Bacillus globigii, an organism that normally doesn't cause disease in humans. It forms spores. The Army researchers had gone to various locations in the New York subway, including the Times Square subway station, and they had dropped the lightbulbs full of spores on the tracks. The lightbulbs had shattered and the spores had flown up into the air in puffs of gray dust. just a few lightbulbs were broken this way, not many, and they contained altogether perhaps ten ounces of spores. Then the Army researchers fanned out and found that within days the spores had disseminated throughout New York City. Spores from Times Square were driven far into the Bronx by the plunger action of the subway trains whooshing through the tunnels — those trains were like pistons, driving the spores in the air through the tunnels for many miles. The spores drifted out of the subway entrances into the neighborhoods. He read: 'A large portion of the working population in downtown New York City would be exposed to disease if one or more pathogenic agents were disseminated covertly in several subway lines at a period of peak traffic.'

'More coffee?' the waiter asked him.

'No thank you. Too much coffee makes me jittery.' 'I know what you mean,' the waiter said.

He left the waiter a generous tip; the waiter was a nice fellow. Outdoors on the sidewalk, he wondered which way to go. East or west? North or south? He headed eastward along a tree-lined street. The trees were flowering, but they had not yet put out leaves.

He had conceived a strategy: he would not plan ahead, except in a general sense. Then they couldn't predict his moves. He himself did not know exactly what he was going to do next. He had a pane of viral glass in his pocket. By the end of the day, it would be out in the world. In his apartment, at last count, he had an additional 891 panes of viral glass, sitting in jars. They would go into the world too. Most of them all at once. Looking for a place to let the crystal go, he walked from Washington Square Park eastward along Waverly Place, past the gracious buildings of New York University. He liked being lost among the students. Their energy pleased him. He walked up Astor Place past the Cooper Union, and then headed along St Marks Place through the heart of the East Village.

Here he reached into his jacket and removed a rubber surgical glove from the pocket and put the glove on his right hand as he walked. No one paid any attention. The glove was to protect his skin from coming into contact with any brainpox particles when he opened the flask and released the crystal into the city.

Continuing eastward across First Avenue, he came to where Manhattan extends in a bulge into a curve of the East River. The avenues there are named A, B, C, and D. The predominant color of Alphabet City is gray, in contrast to the brickreds and greens of the sleeker and richer Greenwich Village to the west. Yet the gray of Alphabet City is mixed with the yellows and greens of bodega signs, Caribbean pinks, and the purples and whites and blacks of hand-painted signs on junk stores and dry-cleaning shops and cafes and music shops and clubs. Many buildings have been torn down over the years, and so the neighborhood has abandoned lots, some of them with homemade gardens.

As he passed through Tompkins Square Park, he had an idea. The park has a playground for children, and grassy areas with benches and walks. There are public toilets there, and so it is popular with homeless people and stray teenagers. He thought that he might leave the piece of glass on a bench where a drunk or a messed-up teenager would encounter it, sit on it, break it, shatter it, throw particles in the air, particles that would,get on the test subject's clothes and eventually perhaps into the lungs. It would be a therapeutic execution.

He cruised past the benches. He saw a couple of drunks lying on their stomachs or backs on the benches, dead to the world. They don't move enough. A group of teenagers were sitting on the ground in a circle, some of them drinking beer out of paper bags. They couldn't be more than sixteen years old. They stared at him as he passed, giving him that nasty, knowing look of teenagers. He had better not do anything in front of them. They would notice.

He was feeling frustrated; he had been walking for a while, and he hadn't encountered anything quite right. Then he had another idea. It might be taking a chance to do it so close to home, but as far as he could tell, they had not figured out the human trials. He turned south, heading for Houston Street. This might bring more peace to his laboratory. He arrived at the little people's park surrounded by a chain-link fence that lay next to his building. It was a nice little park, to be sure, with its gardens. Interestingly, it was deserted. Good.

He sat on the children's merry-go-round. It creaked under his weight. I could also come down here with a little bit of oil; that might help too. Then, using his gloved hand, he unscrewed the cap of the flask. He tipped the flask, and the piece of viral glass slid out onto the merrygo-round.

They will be back. They will jump on the merry-goround, and they will yell and throw rocks at the cats, and meanwhile, their feet will be pounding the crystal to dust. Shake the dust from your feet, children. You are a burden to the earth.

Hector Ramirez, five years of age, was just about to climb up the slide when he changed his mind and went over to the merry-go-round. His mama sat on a bench talking with another lady. He climbed up on the merry-go-round and stood there for a moment. You needed to have more kids to get it moving, but he thought he could get it moving anyway. He climbed down and pushed it, and it began to turn with a squeaky sound, but not much. 'Mama! Mama! Spin me.'

His mama didn't want to spin him. He was about to run off to the Slide when he Saw the little nice thing. He thought it might be candy. It looked like… Sugar? He picked it up. It had colors in it, like a rainbow. He Sniffed it, but there waS no smell. He put it in his mouth. It seemed to turn rubbery and melt in his mouth real fast, but it didn't taste like candy. 'Ew!' he Said. He Spat out Some rubbery bits.

It had tasted like… nothing.

He bent over and spat again, and again, and looked over at his mother.

'Hector! What are you doing?' 'Nothing, Mama.'

She waS young and pretty. She wore a short Skirt and a denim jacket and black boots. 'What are you doing?' He couldn't give her any kind of answer, so she gave up and went back to talk with the other lady. Oh, well. He went off to slide down the Slide.

The cold symptoms come on in a matter of hours. The eclipse phase — where no obvious symptoms appear in the central nervous System — lasts from one to three days. Meanwhile Cobra is rocketing along the wires. The infected brain cells switch into crystal-phase production, and the cells plump up with cryStalS. The transformation of the personality is abrupt and devastating. The Shift to autocannibalism happens explosively. It often occurs when the infected host is momentarily Startled or confused, or is experiencing strong emotions.

Briefing

The forensic operation had been going flat out on Governors Island for nearly eighteen hours. The Reachdeep team had generated a lot of information, but the information was leading nowhere fast.

An epidemic task force from the C.D.C. had arrived and set up Shop in an empty Coast Guard building, and they had been making telephone calls and going around the city, looking for any new cases of Cobra and locating people who had been in close contact with those who had died. Walter Mellis had flown down to Atlanta with samples from the autopsies for the C.D.C.'s molecular biology labs, and USAMRIID waS also starting an analysis.

Reachdeep worked in isolation. Frank Masaccio believed that the team needed to focus on the criminal evidence. No one was allowed to telephone Reachdeep without placing the call through Masaccio's office, but Reachdeep could phone out anywhere. No one was allowed to land on the island and enter the Reachdeep unit unless it was okayed by Masaccio or Hopkins, but Reachdeep team members were given Standby helicopters ready to fly them anywhere they wanted, or ready to fly in experts. 'I've put you guys in an ivory tower,' Masaccio had told them. 'An ivory tower with a helicopter landing zone.'

Seagulls perched on the railings of the observation deck outside the Reachdeep conference room. The gulls looked in the windows at the racks of communications gear, at the people in black biohazard suits.

Two helicopters lifted off from the heliport in lower Manhattan and crossed the East River. They passed over the Coast Guard hospital and touched down in the middle of the island. Five minutes later, Frank Masaccio appeared with a group of men and women, F.B.I. agents and New York Police Department investigators. They were the managers of his Cobra task force. They had arrived for the daily briefing. They were carrying boxes of take-out Chinese food. Lunch.

The New York F.B.I. is experienced in the matter of catering food. The Bureau supplies take-out food to safe houses and stakeouts, since the agents don't have time to prepare their own food or to go out to a restaurant (eating in a restaurant also might draw attention to them). The food must be delivered by other F.B.I. agents, since food-delivery people would be a danger to the security of an operation. Not surprisingly, the New York F.B.I. has the best take-out food capability of any field office in the United States.

The food was excellent. It included Peking duck. There weren't enough chairs to go around. People sat on the floor. For a. time there was no conversation in the room, only eating. Eventually Masaccio brought the meeting to order.

'You start, Hopkins,' he said.

Austen had been sitting curled up against the wall, feeling comfortably alone with herself for the first time in days. Masaccio's voice woke her from her reverie.

Hopkins stood up in front of the Felix devices and summarized the state of the Reachdeep investigation. He said that Reachdeep had made a tentative identification of the Cobra agent. It was a chimera, a recombinant virus engineered in a laboratory. He said it was a mixture of an insect virus and the common cold. Mixing the two viruses had produced a monster. 'But that's not all that's going on in this virus,' Hopkins said. 'We're going to find more engineered DNA wetware in this virus. I'm sure of it.'

Alice Austen gave her autopsy findings. Suzanne Tanaka showed photographs of the virus particles and the crystals in which the particles were embedded. James Lesdiu reported the results of his analysis of the materials in the boxes.

'My number one question is this,' Frank Masaccio said to the Reachdeep team. 'Are you any closer to the perpetrator?'

'It's hard to say,' Hopkins answered.

'That answer sucks, Hopkins. I want the Archimedes perp. I want him yesterday.' Masaccio summarized what had been happening outside Reachdeep. State health officials and the city health commissioner had been brought in and quietly informed of the situation. 'The mayor's Emergency Management Office has been geared up,' Masaccio said. 'We have fire department chemicalhazard and decon teams standing by on Roosevelt Island. We've got New York City Police Department SWAT teams on standby. We are doing our best to keep the news media out of this… One other thing: the mayor is unhappy.'

'With whom?' Hopkins asked.

'With me. He's bouncing off the walls in City Hall. He's yelling on the telephone. Most of the Cobra task force is idle, and it's driving the mayor nuts. You guys aren't giving us enough leads to push. I've got agents running around the city looking for more of those little wooden boxes, but nothing's turned up.' He mentioned that his office had done 'a tiny little news release' to the media. 'What?' Hopkins blurted.

'We had to warn people about the boxes, Will. We're saying it's a poison. We're not giving out that it's a germ weapon. But we can't keep a lid on this thing forever. The minute you guys find something real, you get in touch with me.'

'I need an art historian,' Hopkins said. 'What?'

'An art historian, Frank. Someone who can look at the boxes and tell us where they came from.'

A Brief History of Art

Frank Masaccio flew back to Manhattan, where he stationed himself in the Federal Building. Within the hour a helicopter landed on Governors Island carrying a professor of folk art from New York University. His name was Herschel Alquivir.

The New York office of the F.B.I. had called Professor Alquivir on the telephone and reached him at his apartment on the Upper West Side. They wanted to know if he could help them identify a work of carved wooden folk art. Could he do it right now? Would that be too much trouble?

He agreed to help. He was stunned when, less than sixty seconds after he hung up the telephone, a team of federal agents knocked on the door of his apartment. They had been waiting in cars on the street. He was rushed in a Bureau car with police escort — three police cars moving ahead, breaking up traffic with their sirens and lights — to the West Side heliport. Professor Alquivir was flown to Governors Island, in a state of increasing alarm at what he had gotten himself into.

They brought him into the meeting room and showed him the door that led into the decon room and the Core. The door was plastered with biohazard signs. Hopkins showed Professor Alquivir how to put on an F.B.I. biohazard suit, and then the professor examined the boxes. He was a slender man, middle-aged, with a passion for carved wooden objects. He maintained a calm demeanor. Finally he said, 'These boxes are children's toys. I think they were made in East Africa. I'm quite sure of it. Cobras don't live in East Africa, they live in Egypt, India, and other parts of southern Asia. But the king cobra is known, of course, to many people around the world. And there is a large Indian population in East Africa. I see Indian influences in this box, but the type of object is fundamentally African. This is a type of toy that's not uncommon, I believe, in East Africa. Because of the Indian influence — the cobra — I should say the place of manufacture might be near the coast of the Indian Ocean, where Indian influence is strongest.'

At 9:30 that night, two agents from the New York office of the F.B.I. departed on a Lufthansa flight to Frankfurt, with a connection to Nairobi.

Washington

Archimedes had completed the first phase of his human trials. The boxes were Phase I trials. During a course of medical experimentation upon humans in a Phase I trial, you test small amounts of a new experimental drug on subjects. Phase I trials are safety trials. Having seen the announcement of the boxes on the television news, Archimedes understood that the Phase I safety trials of brainpox showed it was unsafe for humans. Given this success, he would move into Phase II. During Phase II, you increase the dosage and the numbers of people tested. He felt reasonably confident that the results would be satisfactory, but he wanted to have more assurance. After that would come the Phase III trial, when he would give a huge loading dose of brainpox to the human species.

He was uncertain about whether they were looking for him by now, uncertain as to what they might have conjectured about him, if anything.

He was walking through the concourse of Penn Station with a flask containing one hexagon of viral glass tucked in his pocket. He stood looking at the Amtrak departures on the big display board. A Metroliner train was due to be leaving in ten minutes for Washington, D.C. He paid cash for a round-trip ticket to Washington. I have not seen Washington in weeks, he thought. Human trials can occur anywhere humans live.

He had a pleasant lunch of a vegetable pocket pita sandwich on the train, and he enjoyed the green countryside. He delighted in the bridge over the Susquehanna River where it drained into Chesapeake Bay, and he drank a glass of white wine to help himself relax and to steady his resolve. Bridges are beautiful. They are constructive and mathematical. They are one of the good things that humans make.

In the Metro Center Station of the Washington Metro, at midday, a man was sitting on one of the concrete benches along the wall of the station platform. He was breathing rather heavily, as if he was short of breath. A train came along. The man took a deep breath and stood up. As he was walking toward the train, he threw something along the platform, casually, as if he was discarding a bit of trash, and he stepped onto the train. The trash was a shiny bit of plastic, perhaps. It broke into pieces and was quickly trodden underfoot by passing crowds. No one noticed that the man was wearing a flesh-colored latex rubber glove on his right hand or that he was holding his breath when he got on the train. He continued to hold his breath for almost a minute afterward. 'Ah,' he said, letting out his breath as the train proceeded along the tunnel, heading in the direction of Union Station, where Amtrak trains will take you anywhere. He dropped his rubber glove in a trash can somewhere in Union Station.

Dust

The face of an F.B.I. metallurgist appeared on a screen in Reachdeep. 'This Q dust you sent us is a type of mediumcarbon steel. The annealed structure of the particles would indicate they formed through a pressure process such as the hot rolling process.'

'Railroad track,' Austen said to Hopkins.

'There's more,' the metallurgist said. 'We found a grain of something that looks like pollen.'

'Pollen? What kind?'

'We're trying to find out right now.'

The F.B.I. consulted Dr Edgar Adlington, a palynologist (pollen expert) at the Smithsonian Institution in Washington. A special agent named Chuck Klurt walked across the Mall from F.B.I. headquarters to the brown towers of the Smithsonian. Klurt took an elevator to the basement.

Dr Adlington was hunched over his desk in a windowless room that smelled of old books and dried leaves. He was examining a flower under a magnifying lamp.

Special Agent Klurt placed some microscope photographs of a single grain of pollen in front of Dr Adlington. 'We have a little problem. Can you tell me what this is?' 'Well, it is a pollen grain.'

'Any idea what it came from, Dr Adlington?'

'Why do you people have to give me just one grain? Do you take me for a psychic? This is not the kind of thing I can just look up in a book.'

'But could you help?' Special Agent Klurt asked. 'Yes, indeed,' he answered. 'The problem, while challenging, is not insurmountable. What did you say your name is?'

'Klurt.'

'Now, Mr Klurt.' Adlington flipped through the photographs, studying them. The pollen grain looked like a wrinkled football that had grooves running down the seams of the ball. He took a ruler and laid it on the photograph, while his finger traced features on the pollen grain and he glanced at Klurt every now and then to make sure that Klurt understood. 'See, here — what we have here is a colporoidate sporomorph, actually threecolpate, about thirty microns long on the polar axis, in a prolate spheroid with a polar-to-equatorial axis ratio of approximately 1.5, 1 would say, while the sexine — do you see the sexine, Klurt? — you have to bear in mind that the sexine, here, is thicker but not terribly much thicker than the nexine, and it is densely reticulate with heterobrochate form, viz., muri simplibaculate — do you follow me?'

'Yeah.'

'This pollen grain may come from one of several families of the Caprifoliaecae or certain of the Celastraccae, but if I had to say, I would place it in the family Oleaceae.'

'Mmmm — '

'Yes. And I would venture to say we are looking at intermedia or japonica. Perhaps I am going too far out on a limb, here, Mr Klurt, but I would hazard a guess — just a guess! — that this pollen grain comes from none other than Forsythia intermedia "Spectabilis." ' He handed the photographs back to Special Agent Klurt.

'So what is it?' the agent asked.

'I told you, it's forsythia! A flowering shrub. "Spectabilis" is the most beautiful type of forsythia, with large vivid yellow flowers that bloom in April. It is the most popular forsythia in America.'

Forsythia blooms in many places around New York City in the spring. Knowing that the pollen came from forsythia could not help pin down the location of the Unsub. The grain of pollen seemed untraceable.

The cobra boxes themselves came under the scrutiny of a consultant in tropical wood, a middle-aged professor of plant cellular biology from American University in Washington named Lorraine Schild. She arrived at Governors Island in a state of terror.

Professor Schild stood in the decon room before the door that led into the Evidence Core. She was dressed in surgical scrubs. Austen and Tanaka were helping her step into a black F.B.I. biohazard space suit.

'I don't think I can do it,' she said. Her voice quavered. They pleaded with her. They shooed Hopkins and Littleberry away while they tried to reassure her.

'It's my worst fear,' she said. 'There's a horrible virus in there, isn't there?'

'We've been all right, so far,' Tanaka said. 'We really need your help,' Austen said.

Finally they prevailed on Dr Schild, and she suited up and went into the Core. She sat down at a microscope and looked at the wood in the boxes. Austen sat next to her. Dr Schild's voice came out of her Racal hood, muffled and weak. When she had signed a consulting contract with the F.B.I. two years earlier, she had had no idea it could lead to this. She kept turning her faceplate this way and that, trying to see into the microscope. 'The wood cellular structure is extremely fine-grained,' she said. 'This is a very hard wood. The darker streaks are heartwood. The curvature of the rings indicates that it's the center of a small trunk. I believe this is a flowering legume. A wood this hard would suggest it is a type of acacia tree. I can't tell you exactly the species of acacia. There are so many acacias.'

'Where does it grow?' Hopkins asked.

'In habitats all over eastern Africa. Can I leave now?' They took her out and deconned her in the decon room, spraying her with bleach. Dr Schild refused to get back on the Black Hawk helicopter. She asked to be put on a civilian flight back to Washington.

Nairobi

Frank Masaccio had taken to sleeping in the Federal Building, where he had a bed in a room the size of a closet. At one o'clock in the morning, he put in a telephone call to Nairobi, to the Old Norfolk Hotel, where two agents from his office, Almon Johnston and Link Peters, had checked in some hours earlier. It was now Wednesday morning in Kenya. Masaccio told them about the wood. He suggested they look for shopkeepers selling cobra boxes made of acacia wood.

Special Agent Johnston was a tall African-American who had lived in Kenya for a year when he'd been posted there as a sales manager for an American company that did business in Africa, before he'd joined the F.B.I., so he knew his way around. Peters worked in the foreign counterintelligence division of the Bureau. He had never been to Africa in his life.

They were joined by an officer from the Kenya National Police, Inspector Joshua Kipkel, who provided them with a car and a driver. Neither agent knew where to begin looking, but Inspector Kipkel suggested they try some of the better shops — they are called houses — on Tom Mboya Street and Standard Street in downtown Nairobi. So they drove down the streets, stopping at the shops. They looked at the goods for sale. Occasionally the F.B.I. agents purchased something in order to sweeten relations with the shopkeepers. The agents showed them photographs of the cobra boxes. All of them said they had seen such boxes, but they said that they were out of stock at the present time. One shopkeeper offered to ship a cargo container full of cobra boxes to New York but he said he would need a large cash deposit up front. 'I shall have this container shipped to you at a special price.' Inspector Kipkel spoke to the man sharply in Kiswahili.

'M'zuri sana,' Johnston said to the shopkeepers. To Peters and Kipkel, he said, 'This isn't panning out.' Next, Inspector Kipkel suggested they try the Kenya National Museum. He said, 'It has a good tourist shop, and it has collections you may find interesting.'

They explored the National Museum and its gift shop, but they found nothing like the cobra boxes on display or for sale. Inspector Kipkel said, 'We will go to the City Market.'

'Sounds okay to me,' Link Peters said.

'It will be difficult for you there. You will see,' Inspector Kipkel said to them.

Their driver took them to a rotting concrete structure in downtown Nairobi, on a dusty street across from a supermarket. The Nairobi City Market had been built many years earlier by the British, when they had been the colonial rulers of Kenya. It resembled an aircraft hangar. They entered through the front entrance, and immediately they were surrounded by a knot of shopkeepers waving leather goods and carved chess pieces and jewelry. When Johnston showed the shopkeepers photographs of the cobra boxes, the shopkeepers were certain they had seen such boxes. They were certain they could get more boxes for the Americans. In the meanwhile, would Johnston and Peters like to buy anything else? A beaded belt, perhaps, or a set of napkin rings? Silver jewelry? A carved mask?

'Some of this stuff is really beautiful,' Link Peters said to Almon Johnston. Peters stopped to buy some wooden carvings of lions and hippos for his kids. It took the agents two hours to explore the City Market. They circled around the building, stopping at each shop in turn, showing the photographs. It created an unbelievable sensation, a churning knot of commercial hysteria that followed them everywhere they went. Yet no one could show the agents a box of the right type.

It was getting near five P.M., closing time for the Nairobi City Market. Almon Johnston turned to Peters and said, 'I'm beginning to think we should try Tanzania.'

Inspector Kipkel said there was one more possibility. He said they should try outdoors behind the building. They went out through a back door to a dusty open lot jammed with booths of people selling trinkets, people who couldn't afford the rent inside the market building.

Kipkel made the break. He spotted an old lady with some small carvings. She was sitting in a booth off to one side. He went over to her. The boxes looked familiar. 'Gentlemen, come over here.'

Her name was Theadora Saitota. She was selling baskets woven from baobab bark. She also had on display a number of small boxes that were not unlike the cobra boxes, except that they were made of gray soapstone, not wood.

Johnston showed her photographs of the boxes. She eyed the Kenyan police inspector. Then she said, 'I know these things.'

'Where do they come from?' Johnston asked her. 'Voi.'

'What?'

'Voi,' she said.

'This is a town,' the Kenyan police inspector said. 'There are many woodcarvers in this town.' It was a town on the road to the coast.

'Do you know who in Voi makes these boxes?' he asked her.

She looked at the Kenyan inspector, and hesitated. Johnston removed a wad of paper shillings from his pocket and handed the banknotes to the lady. They were worth a few dollars.

She tucked the money away in the blink of an eye and said: 'He was a good man. He was a woodcarver in Voi. He carve things.'

'What is his name?' Johnston asked.

'His name Moses Ngona. He was my cousin. He passed away. Of Slim. Last year,' she said.

'And you sold his boxes until he died?'Johnston asked. 'Yes.'

'Do you have any more of Mr Ngona's boxes?' She looked hard at him and said nothing.

He handed her more banknotes.

She reached down to a shelf beside her knees. She pulled out a roll of old newspaper. She unrolled the newspaper and placed one wooden box on the plank.

Johnston opened it, fiddling with the catch. A snake popped out. A king cobra.

'Do you remember selling any of your cousin's boxes to any tourists?' Johnston asked.

'Not many tourists here,' she said. 'There was a man from Japan. There was a lady and a man from England. There was a man from America.'

'Can you describe the American, the man?'

'He was small.' She began to laugh. 'He had no hairs on his head, he was a little mzungu.' Mzungu means white man and it also means ghost. 'He offer me many dollars, this little mzungu. We have a big business.' She smiled. 'I give him two of my cousin's box! He give me twenty dollars! Ha, ha! This little mzungu! I did have the best of him!' Twenty dollars had made her month.

'When did this happen?' 'Oh, last year.'

Almon Johnston telephoned Masaccio from the Old Norfolk Hotel. It was by then Wednesday morning in New York. Johnston explained what they'd found. 'A man paid the lady twenty dollars. That's way too high a price. And that's why the lady remembers. It suggests the guy may have been planning this crime a year ago, Frank. She's down at police headquarters now. They're getting a composite artist. The lady's saying that all small hairless white men look the same to her. But I think they'll get a face. Link and I could start crosschecking with the Foreign Ministry's visa records. The problem is, about fifty thousand male Americans were issued visas to Kenya during the time period. It'll be a bitch going through them.'

'It's kind of a stretch, guys, but suck it in and start sifting through those fifty thousand visas,' Masaccio said. That afternoon, a fax machine in the Reachdeep unit beeped and extruded a composite drawing of a man's face. He wore glasses. He had a narrow nose and rather puffy cheeks. He was nearly bald, and he looked to be in his thirties or forties. He was a possible suspect. On the other hand, he may have been just another American tourist. Hopkins taped the drawing to the wall, where all the team members could see it.

Case

Suzanne Tanaka studied the drawing of the face on the wall. Like all of the Reachdeep team members, she couldn't keep her eyes off it. Was this really the man? Feelings of great terror engulfed her, terror that she couldn't describe, and the feelings kept her awake all the time now. She said not a word to the others of her fear.

In the biology room of the Evidence Core, Tanaka inspected her mice. One animal seemed more active than the others, and began grooming itself for long periods of time, but the periods of grooming activity were interspersed with periods of what looked like paralysis, when the mouse wouldn't move. Then it attacked itself. It gnawed at its front paws, and pulled out some of its hair, especially in the belly. But the animal did not die.

With Austen watching, Tanaka killed the mouse and dissected it. She placed it on a cutting board, and, wearing triple gloves and full biohazard gear, she opened the mouse with a scalpel and obtained a sample of the mouse's brain. She prepped the brain material and scanned it in the electron microscope. Some of the mouse's brain cells contained Cobra crystals, but on the whole, the brain tissue seemed less damaged than with humans infected with Cobra. The virus seemed to produce a nonfatal infection in a mouse.

Then another mouse got sick. It curled up and groomed itself for hours on end. Two other mice also seemed trembly. Tanaka wanted to look through an optical microscope at brain cells of the mouse she had sacrificed. She made thin slices of mouse brain, stained them, and looked at the slices through the doubleheaded microscope. Austen stared into the other set of eyepieces.

'When did you see the first signs of illness in this mouse?' Austen asked.

Tanaka didn't answer. 'Suzanne?'

'Oh, ah, last night, I guess. It was agitated. That was the first sign. I guess.' She took her eyes away from the microscope and bent over.

'Are you all right?'

'I'm fine.' She went back to looking into the eyepieces. Austen kept looking at Tanaka. 'I haven't seen you sleep since we arrived, Suzanne. I haven't seen you eat.' 'I don't seem to have time.'

'You need to find the time. I mean this,' Austen said gently.

Austen moved the slide and replaced it with another one. They were looking, now, at the mouse's midbrain. It was not unlike the human midbrain, a core of material with a lot of branching nerves coming out of it, at the top of the animal's spinal cord.

Austen moved the slide. 'I think we're looking at the basal ganglia,' she said. That was a bundle of nerve fibers in the mouse's midbrain. The cells contained crystals in the center, and they were hairy with branches. 'It's as if the basal ganglia started to grow. Like there's been some kind of reorganization of all the connections. What do you think?'

'Think? I… can't think.' 'Suzanne?'

Austen looked up across the top of the doubleheaded microscope. She was not two feet away from Tanaka's face. Suzanne's lips were trembling. A drop of clear liquid fell from her nose.

'Suzanne!'

The Army Medical Management Unit placed the first team casualty, Technician Suzanne Tanaka, in a biocontainment hospital room on the second floor. They set up an access vestibule, where nurses and doctors could change into protective clothing before they entered. They started Tanaka immediately on an IV drip of ribavirin, a drug that is known to slow down the replication of some viruses. They told her not to worry, that they hoped her illness would prove treatable. Yet with all their technology, they were as helpless as doctors had been in the Middle Ages in the face of the Black Death. They set up monitoring machines in her room and started her on Dilantin, an antiseizure medication. When she tried to chew on her wrists and fingers, they tied strips of gauze around her hands, but she tore them off with her teeth, so they had to restrain her arms with nylon straps tied to the bed frame. She was not incoherent, and she was deeply apprehensive of the future. Most of all she was afraid of dying alone, but she didn't want her family to see her in this condition. 'Will you stay with me, Alice?' she said in a thick voice. A nurse wearing a mask and protective suit wiped the sweat off her face.

Austen stayed with Tanaka as much as possible. Tanaka said that she didn't feel very sick, just very 'coldy.' She did not know why she wanted to, do 'that thing.' She could not find a word for wanting to destroy herself with her teeth.

A team of four epidemiologists from the C.D.C. had been stationed on Governors Island in their own quarters. They had spent the past two days interviewing case contacts, taking blood samples from people who might have been exposed to the virus, and calling area hospitals. One of the C.D.C. people, an epidemic intelligence officer named Gregory Katman, found a new case.

At New York Hospital, a man had been brought into the emergency room having continual seizures. He had begun biting his mouth severely while having dinner with his wife in a restaurant on the Upper East Side of New York. His name was John Dana. An Army medevac helicopter was sent to New York Hospital from Governors Island. By the time the patient-transfer documents had been filled out, John Dana was dead.

Alice Austen and Lex Nathanson did the autopsy and made a diagnosis of Cobra virus infection. Dana's body was federal evidence and could not be released to the family.

C.D.C. investigators, working with some of Masaccio's task-force agents, interviewed the Dana family. They lived in Forest Hills, Queens. The investigators discovered that John Dana had been walking across the subway platform in downtown Brooklyn on the Saturday morning when Peter Talides was killed on the tracks. Dana was the man who had wiped specks of brain material from his glasses. He had been infected with Cobra through the eyes. The United States Public Health Service put his wife under quarantine. She was installed in a hospital room on Governors Island, where her two daughters were allowed to visit her.

John Dana had been infected with the Zecker-Moran isolate of Cobra virus. It had passed from Kate Moran to Peter Talides, and from Talides to John Dana. It had undergone three generations of infection in humans. It did not seem to become weaker as it moved from person to person. Austen found that the clinical signs of Cobra in Dana at autopsy were very much like those in Kate Moran.

Mrs Helen Zecker, the mother of Penny Zecker, was found dead in her house in Staten Island by a C.D.C. investigator. Mrs Zecker's body was lying on her recliner. 'It' had gotten her, as she had feared and predicted. The deaths led Austen to believe that Cobra was capable of sustaining itself in the human species, in a perhaps unlimited chain of human-to-human transmission.

Recombination

Hopkins continued to use the Felix machine to decode the genetic material in Cobra. The DNA of the Cobra virus contained roughly 200,000 bases of code. That made it one of the longest and most complicated genetic codes in any virus. Many viruses, especially those that use RNA rather than DNA for their genetic material, contain some 10,000 bases of code. A DNA virus with a long genetic code, like Cobra, is eminently usable as a genetically engineered weapon, because a lot of extra code can be added to it without damaging the virus and rendering it incapable of being able to multiply.

All day and much of the night, Hopkins ran samples of blood, tissue, and dust through Felix, pulling up genetic sequences from Cobra and trying to identify them. The process was like putting together a very large jigsaw puzzle. Gradually the structure of the organism's genes became clearer to him, yet parts of it mystified him. Cobra was a recombinant virus that had been engineered with skill and subtlety.

'It's a world-class weapon,' Hopkins said to Littleberry and Austen one day. 'It didn't come out of somebody's garage, that's for sure.'

Hopkins was staring at the screen. 'Uh-oh. Look at this,' he said. He had just fed a piece of code into GenBank. This is what had come up on the screen:

Sequences producing High-scoring Segment Pairs:

'Wow! Variola major! That's smallpox,' Hopkins said, pointing to the screen. 'Cobra's part smallpox. That is really clever.' He turned to look at Littleberry and Austen.

Littleberry wasn't answering. He was staring at the screen.

Littleberry made a fist. He brought his fist down on the table with a crash. 'God damn it!' he said. 'God damn it! Those sons of bitches!' He turned and walked away. He went out on the deck by the conference room and stood by the rail, staring across the waters of New York Bay. He stayed there for a long time. The other members of the team decided not to disturb him. Hopkins carried on into the night, analyzing the code with Felix, muttering strange terms to himself — 'Open reading frame… virulence factor A47R…'

Invisible History (III.)

Security matters in the federal government are compartmentalized. Information from one agency flows to another agency through top managers. The flow is controlled by bureaucrats and intelligence people. This means that parts of the federal government don't know what other parts are doing. Files are routinely destroyed, for security purposes, and people retire and die. The United States government does not know parts of its own history. The knowledge remains hidden in pockets.

In times of emergency, someone in one branch of the federal government may suddenly need information from someone in a different branch. Then people have to sit down in a room with each other and trade sensitive information by means of an informal conversation. This is secret oral history. It is not supposed to happen. It happens all the time.

Mark Littleberry telephoned Frank Masaccio and told him there was an area of knowledge that he, Masaccio, needed to become aware of, under conditions of security. Shortly afterward, Littleberry and Masaccio entered the F.B.I. Command Center in the Federal Building. It was night, and the room was deserted except for one agent, Caroline Landau, who was working on some video feeds. Masaccio stopped before a steel door on the west wall of the Command Center. It was the door to a room known as Conference 30–30. It is a secure room — actually a Mosler steel safe. He touched a combination keypad, and the two men settled in chairs around a small table, and the door clicked shut.

From the corner of her eye, Caroline Landau had watched the two men go into the secure room, and she had understood that it had to do with Cobra. I wonder if an operation is going down? she thought. She could feel an operation gathering in the air, like a weather front coming, bringing a gentle pickup of the wind, and the smell of a building electrical storm.

'We've found a lethal smallpox gene in the Cobra virus,' Littleberry said to Masaccio.

'Yeah?' It didn't mean much to him.

'Will calls it the rocketing gene. It makes a protein that rockets the virus particles around the infected cell. You could think of it as fireworks going off inside the cell. It destroys brain cells while it shoots the virus everywhere. That's why these people die so fast, Frank. The virus is rocketing through their brains. Cobra is part smallpox.'

Masaccio sucked his teeth and played with his class ring on his finger. 'Fine, but when are you guys going to find me the perp?' he said.

'What you're trying to do is change the outcome of history, you know,' Littleberry said.

Masaccio replied that he was well aware of that. Littleberry settled back in the chair, feeling tired in his bones, and he wondered how long it would be before he could see his grandchildren and feel a wind from fhe Gulf of Mexico on his face. Finding a piece of smallpox in the Cobra virus was like… dying.

'It's strange, Frank. I'm proud of what I did as a scientist. But I'm sorrier than ever for what I did as a human being. How do you reconcile that?'

'You don't,' Masaccio said.

'Something happened to me late in the program. I mean in the American biological-weapons program. Late 1969. Just before Nixon killed it.'

The U.S. Army's biological-weapons-production facility was the Biological Directorate plant in Pine Bluff, Arkansas. In 1969, Littleberry had received an invitation from some Army researchers to visit the plant and see warheads being loaded. He watched workers packing bomblets with dry anthrax. They were wearing breathing masks and coveralls, and that was it. No protective space suits.

'I'm looking at these guys, and I realize that they are all black guys,' Littleberry said to Masaccio. 'The overseers were white. It was African-American men filling germ bombs, with the white guys telling them what to do.'

He had tried to put it out of his mind. He had tried to tell himself that the men had well-paying jobs. He had tried to tell himself that the military had been good to him. 'It took me way too long to get through my stubborn head the reality of what was going on in Arkansas. It was expendable nigger-labor in a disease factory, that's what it was.'

When Nixon shut down the American biologicalweapons program in 1969, Mark Littleberry was out of work. 'Nixon put me out of a job, and I'm thankful. All I had to show for my M.D. was thousands of dead monkeys and some super-efficient biological weapons.'

'Hold on,' Masaccio said. 'What I hear is that the biological shit was unusable. I hear that it wouldn't work.'

'Where'd you hear that?' 'All my sources.'

'That's crap,' Littleberry said. 'That is pure crap. It's the kind of unreal crap we've been hearing for years from the civilian scientific community, which has its head in the sand about bioweapons. We tested strategic biosystems for five years in the Pacific Ocean. We tested everything at Johnston Atoll, the lethal' stuff, all the means of deployment. Not everything worked. That's the whole point of research and development. But we learned what works. Believe me, those weapons work. You might not like the way that they work, but they work. Who told you the weapons don't work?'

'Ah, one of our academic consultants. He has security clearances.'

'An academic with security clearances. Did this guy describe what happened at Johnston Atoll?'

Masaccio didn't answer.

'Did he mention Johnston Atoll?' 'Nope.'

'Then let's get back to reality,' Littleberry said. 'Nixon suddenly killed the program in late 1969. It was his decision to kill it. I was agonizing over this goddamned program, whether I should leave it, and Nixon killed it. I won't forgive Nixon for taking away a decision that I should have made for myself.'

Littleberry decided that he had to do something to make up for his work with weapons. He applied to switch his officer's commission into the Public Health Service, and he went to work for the Centers for Disease Control, where he took part in the war on smallpox. In the early 1960s, a handful of doctors at the C.D.C. had an important idea. Their idea was that a virus could be eradicated from the planet. They chose the smallpox virus, variola, as the most likely candidate for total extinction, because it lives only in people. It doesn't hide in the rain forest in some animal where you can't eradicate it.

Littleberry reached into his hip pocket and pulled out his wallet. He removed a small photograph. It was old and dog-eared, covered with plastic. He had been carrying it in his wallet for twenty years. He pushed it across the table toward Masaccio. 'This is the work that made me whole.'

The photograph showed a thin African man standing in a parched landscape, beside a fence. He was squinting away from the camera. He wore no shirt. Blisters speckled his shoulders, arms, and chest.

'Should I know him?' Masaccio asked.

'Nope,' Littleberry said. 'But if you were a public health doctor you would. His name was Ali Maow Maalin. He was a cook. The place is Somalia, the date's October 26, 1977. Mr Maalin was the last human case of smallpox. The smallpox life-form has never made another natural appearance anywhere on earth. That was the end of the road for one of the worst diseases on the planet. I was there, with Jason Weisfeld, another C.D.C. doctor. We vaccinated everyone for miles around. That bastard wasn't able to jump from Mr Maalin to any other host. We wiped out that bastard. By we I mean thousands of public health doctors all over the world. Doctors in India. Doctors in Nigeria and China. Doctors in Bangladesh with no shoes. Local people. Today I'm afraid you have to wonder just how successful that smallpox campaign really was.'

What Littleberry had in mind was the surprise that history and nature came up with in 1973, four years before the last naturally occurring case of smallpox and just a year after the signing of the Biological Weapons Convention. It was the biotechnology revolution.

Genetic engineering is all about moving genes from one organism to another. A gene is a strip of DNA that carries the code for making a particular protein in a living creature. A gene could be thought of as a piece of ribbon. A microscopic ribbon. The ribbon can be cut and pasted. Molecular biologists use certain splicing enzymes, which act as scissors, and which cut DNA. (Molecular biology is largely a matter of cutting and pasting ribbon.) You can snip the DNA where you want. You can chop it out of a longer piece of DNA, then put it into another organism. That is, you can transplant a gene. If you do it correctly, the organism will have a new working gene afterward. The organism will do something different; it will make a new protein. It will be a changed living creature, and it will pass its changed character to its offspring. If you allow the organism to multiply, you've cloned the organism. A clone is a designer copy. This is genetic engineering. One of the big complications is that when you move DNA from one organism to another it doesn't always work properly in its new home. But it can be made to work. An organism that contains strips of foreign DNA is known as a recombinant organism.

The biotechnology revolution began in 1973, when Stanley N. Cohen, Herbert W. Boyer, and others succeeded in putting working foreign genes into the bacterium E. coli, a microorganism that lives in the human gut. They made loops of DNA, and they managed to stick the loops inside E. coli cells. The cells were different afterward, because they had extra working DNA inside them. Cohen and Boyer shared the Nobel Prize for this achievement. The genes they transplanted gave E. coli resistance to some antibiotics. The organisms with their new features, their resistance to antibiotics, were not dangerous. They could easily be wiped out by other antibiotics. The experiment was perfectly safe.

Cohen and Boyer had accomplished one of the historic experiments in twentieth-century science. It would lead to the growth of new industries in the United States, Japan, and Europe. New companies would be formed, diseases would be cured in new ways, and great insights into the nature of living systems would follow.

However, almost immediately, scientists became worried that moving genes from one microorganism to another could cause outbreaks of new infectious diseases, or environmental disasters. The concern was very great: recombinant organisms were frightening to think about. Concerned scientists urged a temporary halt in genetic experimentation until the scientific community could debate the hazards and come up with safety guidelines to prevent accidents. A meeting to discuss these issues took place in Asilomar, California, in the summer of 1975.

The Asilomar Conference brought a sense of reason and calm to a situation that had seemed inherently frightening. After the Asilomar Conference, scientists proceeded cautiously in the area of genetic engineering. The so-called Asilomar Safety Guidelines for carrying out genetic experiments on microorganisms were established, and a variety of safety review boards and procedures were put in place. As it turned out, the concerns of Western scientists about the hazards of genetic engineering provided a blueprint for what was to become the Soviet bioweapons program.

Around this time, a certain Dr Yuri Ovchinnikov, one of the founders of molecular biology in the Soviet Union, and some of his colleagues pitched the idea of a geneticweapons program to the top Soviet leadership, including Leonid Brezhnev. Soon the Soviet leader began sending word down to the Soviet scientific community: do research in genetic engineering and you will have money; if your research has applications for weapons, you will be given what you need.

In 1973, the year of the Cohen and Boyer cloning experiment, the Central Committee of the Soviet Union had established an ostensibly civilian biotechnology research and production organization called Biopreparat. Participating scientists sometimes called it simply 'The Concern.' It was controlled and funded by the Soviet Ministry of Defense. The main business of Biopreparat was the creation of biological weapons using advanced scientific techniques. The first head of Biopreparat was General V. 1. Ogarkov.

In 1974, the Soviets established a complex of research institutes in Siberia devoted especially to developing advanced virus weapons using the techniques of molecular biology. The centerpiece of the complex was the Institute of Molecular Biology at Koltsovo, a selfcontained research complex in the birch forests twenty miles east of the city of Novosibirsk. The cover story was that the institute of Koltsovo was dedicated to making medicines. But for all the state research money spent on 'medicines' in Biopreparat, the Soviet Union suffered a chronic lack of the simplest medicines and vaccines. It seems pretty clear that the money wasn't being spent on medicine.

Most of the leading scientific figures in Soviet microbiology and molecular biology took military money and did research that was connected to the development of bioweapons. Some of the scientists lobbied for the money. Others didn't know what was going on, or didn't want to ask too many questions. In the West, there was strong, vehement, entrenched resistance to the idea that biological weapons work, and there was a worthy but perhaps naive hope that the Soviets would be reasonable about such. weapons. Scientists in general believed that the treaty was working remarkably well. Biologists in particular congratulated themselves for being more alert and wise than the physicists, who had not managed to escape the taint of weapons of mass destruction.

Meanwhile the intelligence community kept leaking allegations about a biological-weapons program in Russia. Scientists were (quite reasonably) suspicious of intelligence information of this kind — it wasn't backed by much hard evidence, and it seemed to come from rightwing military people and from paranoids in the C.I.A., who, it was felt, tended to demonize Russia to serve their own interests. People who tried to say that the Soviets had used toxin weapons on hill people in Southeast Asia were pilloried in scientific journals. In 1979, when airborne anthrax drifted across the city of Sverdlovsk, killing at least sixty-six people (perhaps many more than that), American experts in biological weapons declared that the citizens of the city had eaten some bad meat. The chief proponent of this view was a Harvard University biochemist named Matthew S. Meselson, one of the architects of the Biological Weapons Convention. He had helped persuade the Nixon White House to embrace the treaty. Meselson insisted that the anthrax accident at Sverdlovsk had been a natural event. His view prevailed for a long time, even though there were those who said that the Sverdlovsk incident was an accident involving biological weapons.

Then in 1989, Vladimir Pasechnik, a top Biopreparat scientist, defected to Great Britain. Pasechnik had been the director of a Biopreparat research facility known as the Institute for Ultrapure Biological Preparations, in Leningrad. British military intelligence gave Pasechnik the code name Paul. The British intelligence people spent months debriefing 'Paul' in a safe house in the English countryside about fifty miles west of London.

Pasechnik spoke of massive biowarfare facilities hidden all over the Soviet Union. The Soviet Union, he said, had deployed a variety of operational strategic biowarheads on intercontinental missiles that were targeted all over the place and could be loaded with hot agents and launched quickly. Large stockpiles of hot agents were kept in bunkers near the launch sites, including massive amounts of smallpox. Dr Pasechnik spoke very knowledgeably of genetic engineering — he knew exactly how it was done. He said that genetic engineering of weapons was a recent focus of work in his own laboratory. He said it had been done in a variety of places in the Soviet Union with a variety of hot biological agents.

President George Bush and Prime Minister Margaret Thatcher were briefed on the situation. It seemed possible that Pasechnik was exaggerating. Much of what he claimed was difficult to verify. The Soviet Union clearly had a biological-weapons program, but what was the extent of it? Bush and Thatcher put intense personal pressure on Mikhail Gorbachev to come clean about bioweapons and allow an inspection team to tour some of the Soviet bioweapons facilities.

This was in the late fall and early winter of 1990, when the Soviet regime was in the process of crumbling in a welter of glasnost and perestroika, and the Soviet Union was heading for economic collapse and eventual breakup. At the same time, President Bush was preparing to go to war with Iraq. (The Gulf War started in January 1991.) American and allied troops were pouring into the Persian Gulf. Intelligence reports indicated that the Iraqis possessed an arsenal of biological weapons, but the Iraqi capabilities were not known. It suddenly appeared that the United States had been caught flatfooted in respect to biological weapons, both in the Soviet Union and in the Middle East.

'I was only one man in a group of inspectors,' Littleberry said to Masaccio, 'but I think I can speak for all of my colleagues.'

Just before Christmas 1990, Mark Littleberry and a group of Americans were flown to London on their way to Russia for an inspection tour. Some of the Americans were C.I.A. analysts. some were in the F.B.I., some were U.S. Army experts, and some, like Littleberry, were private scientists who happened to know a great deal about biological weapons.

The inspection team had a long wait in London. It was said that the procedure for inspecting Russian biological facilities was proving difficult to work out in detail. What was actually happening was that Gorbachev was stalling the inspection team in order to give his military people a chance to move the five weapons stocks out of the facilities and sterilize the buildings with chemicals. Suddenly, in January 1991, the team was told it was going in to have a look. While the world was preoccupied with the Gulf War, the inspectors flew to various sites in the Soviet Union.

If there were any veils over their eyes before they went in, the veils fell away quickly. One inspector, an American who is an expert in advanced biotechnology production processes involving genetically engineered vaccines, would later say that when he went in, he was sure that the problem in Russia had been exaggerated by military people and by intelligence analysts. By the time he left, he had come to believe that the problem was so bad that it was impossible to see the bottom of it. It was 'very scary,' he said.

There were approximately sixteen identified major bioweapons facilities in the Soviet Union (or as many as fifty-two, if the smaller ones are counted). The team visited only four of them. The facilities were of two basic types: weapons-production facilities and research-anddevelopment labs. Forty miles south of Moscow, near a town called Serpukhov, the teams explored the Center for Applied Microbiology at Obolensk, a large Biopreparat facility. Obolensk consists of thirty buildings. It is at least ten times the size of the USAMRIID complex at Fort Detrick. The main building at Obolensk is called Corpus One. It is eight stories tall, and it covers more than five acres of ground. It is an enormous monolithic biological laboratory with one and a half million square feet of laboratory space, making it one of the largest biological research facilities under one roof anywhere in the world. Corpus One is surrounded by triple layers of razor wire. The perimeter security includes tremblors (groundvibration sensors), infrared body-heat detectors, and armed guards from the Special Forces. Inside Corpus One, the team had a chance to explore Soviet hot zones.

They discovered that the design of Corpus One is different and somewhat more sophisticated than the design of the hot zones at USAMRIID or at the Centers for Disease Control in Atlanta. Obolensk Corpus One has ring-shaped hot zones, levels within levels. The hot core is at the center of the building, surrounded by concentric rings of graduated biohazard security, so that as you approach the building's center, you go from Level 2, to Level 3, to Level 4. The Soviet scientists were justifiably proud of their ring design. They were also proud of their green AP-5 biohazard space suits. The Americans who tried them on said they were more comfortable than American biohazard suits.

At Corpus One, the focus of research was Yersinia pestis, a bacterial organism that causes the plague. This is the organism that in the Middle Ages had killed off a third of the population of Europe in one sweep during the time of the Black Death, around 1348.

The scientific director of Obolensk was a hawk-faced microbiologist and military general named Dr N. N. Urakov. He had long, silvery, thick, straight hair that he wore swept back over his forehead. Urakov seemed to be a man without emotion, except when he spoke of the power of microorganisms, and then his voice resonated with commitment.

The inspection teams found research areas in Corpus One that were designed for rapid mutation and fast selection of strains of plague while the strains were exposed to ultraviolet light and nuclear radiation. They came to the conclusion that the researchers were doing forced mutation and selection of strains of Black Death that could live and multiply in a nuclear-battle zone. The Obolensk Black Death was a strategic weapon. Team members would later offer the opinion that the Obolensk Black Death was fully weaponized and integrated into the Soviet Union's strategic forces and its war plans. It was a strategic bioweapon on two counts. First, it was apparently deployed in intercontinental strategic missile warheads targeted all over the planet, and second, it was highly contagious and incurable with medicine.

The inspectors found forty giant fermenter tanks inside Corpus One's hot zones. The tanks were used for growing huge quantities of something. They were twenty feet tall. The fact that they were placed inside the biocontainment zones was evidence that they were for growing hot agents. The tanks were about the largest reactor tanks that any of the inspectors had ever seen. Why would any legitimate medical research program need forty tanks for growing Black Death and other organisms, tanks twenty feet tall, inside a hot containment area that was surrounded by intense military security? One of the inspectors would later say that he thought you could supply the entire national output of the Iraqi biologicalweapons program at the time of the Gulf War with a single Obolensk reactor tank. And there were a number of bioweapons-production facilities the scale of Obolensk scattered across Russia.

The production equipment in Corpus One was sparkling clean and sterile when the inspectors arrived. The rooms and tanks smelled of bleach and chemicals. All of the living biological materials, the so-called seed stocks and growth media, had been removed from the parts of Corpus One that the inspectors were allowed to visit. The team took swab samples, but nothing grew in the test tubes.

Dr Urakov insisted to the Americans and the British that the medical research at Obolensk was entirely peaceful in nature. When asked by the inspectors why the Soviet Union had built a heavily guarded military research site, with one and a half million square feet of space, with forty reactor vessels two stories tall, much of it dedicated to Level 4 space-suit research and production of Black Death, Dr Urakov answered that Black Death was a problem in the Soviet Union.

The inspectors agreed with him on that score. However, they pointed out that the Soviet Union was reporting only a handful of deaths from plague every year, so plague couldn't be that much of a problem. Especially, they said, because plague is controllable with simple antibiotics.

Dr Urakov answered that in a country as large as the Soviet Union there was 'a need for research.'

The inspectors began to ask questions about genetic engineering. Did the need for research include the need to do genetic engineering of Black Death for the purposes of creating a weapon?

Dr Urakov's answers were disturbing. He suggested that his people were working with strains of Black Death that were incredibly deadly — strains you would not believe. He claimed they were natural strains. He said that vaccines didn't work on the strains. The inspectors had the impression that he was making veiled boasts about his staff's accomplishments in genetic engineering, but they couldn't be sure. Urakov and his colleagues stunned the inspectors by offering to arrange for a 'technology transfer' with the United States, whereby the United States would have access to the discoveries at Obolensk — for an unstated price. They insinuated that since the United States had fallen behind the Soviet

Union in the area of biological weapons, the inspections were a cover — an excuse to pry into what Soviet scientists had done, so that the United States could play catch-up.

In fact it is easy to put antibiotic-resistant genes into bacteria — it's a basic technique, nothing fancy. Subsequent reports from Western intelligence agencies alleged that, in fact, the Obolensk Black Death was resistant to sixteen antibiotics and to nuclear radiation. How the Russians had actually developed such a strain — if they had — wasn't clear. Had they used genetic engineering, or had they used more traditional, tried-and-true methods for developing hot strains? In any case, the United States lodged a demand with the government of Russia for an explanation as to whether Russia did or did not have a weapons-production Black Death that was multidrug resistant. To date, Russian biologists and political leaders have. not given any answer to this question that makes sense. There have been only vague denials.

'That Obolensk Black Death is an amazing product,' Littleberry said. 'It is basically incurable with medicine. And it is contagious as hell in humans. If someone threw a pound of Obolensk Black Death into the Paris Metro, you would not want to be living anywhere near Paris. One of our big concerns is that the Russian government appears to have lost control over these engineered military strains.'

The inspection team flew to the city of Novosibirsk, in western Siberia. Twenty miles east of the city, in a forest of birch trees and larches, is the bioresearch complex known as the Koltsovo Institute of Molecular Biology. It consists of about thirty buildings. The buildings contain a variety of hot zones in the ring-shaped Russian design. Here the focus of research is on viruses — Ebola virus,

Marburg virus, a South American brain agent called VEE (Venezuelan equine encephalitis), Congo-Crimean hemorrhagic fever, tick-borne encephalitis (another brain virus), and Machupo (Bolivian hemorrhagic fever).

The team learned that the Koltsovo research facility had bioreactor tanks designed for growing smallpox virus. It dawned on them that Soviet smallpox militaryproduction capacity could be many tons a year.

Littleberry was stunned. 'It was one of the worst moments of my life,' he said to Masaccio. 'I was thinking of those doctors in India and Africa, fighting smallpox inch by inch, and meanwhile this Biopreparat monster was making smallpox by the ton.'

It came out that Koltsovo was not the only place in Russia that had smallpox military-production capacity. There were two other places. One was a facility in a city just outside Moscow called Zagorsk (now Sergyev Posad), and another military smallpox weapons-production plant was at Pokrov.

Littleberry: 'This story you hear about how smallpox is just kept in one freezer in Russia today? Complete bullshit. The Russian Ministry of Defense is keeping seed stocks of smallpox virus at multiple locations in military superfreezers. The Russian military people are not gonna give up their smallpox, no way. Smallpox is a strategic weapon. It's especially valuable as a weapon now that the natural virus has been eliminated from the human population.' Most people on earth have lost their immunity to smallpox. It is incredibly lethal and infective. One person infected with it can easily infect twenty more people, so a small outbreak in a population lacking immunity will mushroom into a lethal burn. 'We all think we're protected because we had our smallpox vaccinations as kids,' Littleberry said. 'Bad news — the smallpox shot wears off after ten to twenty years. The last shots were given out twenty years ago. Except to soldiers. Soldiers still get them.'

The world's total supply of smallpox vaccine currently stands at enough shots for half a million people — enough to vaccinate one out of every ten thousand people worldwide. If smallpox started jumping from human to human in a global outbreak, smallpox vaccine would become more valuable than diamonds. On the other hand, smallpox can be engineered to elude a vaccine, rendering the existing vaccine worthless.

At Koltsovo, the research staff admitted to the inspectors that they were 'working with the DNA of the smallpox virus.' The statement shocked the inspectors. It shocked them as much as anything they had encountered. They did not understand what it meant to 'work with the DNA of smallpox,' so they asked for clarification.

The answers were vague. The inspectors went nose to nose with the Russian scientists. What did you do to smallpox? They pushed. They pushed harder. No answers came back. The situation became extremely tense, steel-hard with national-security implications, and it turned into a standoff. The British inspectors were especially appalled, and they flayed the Russian Scientists verbally for their irresponsible and dangerous research. In the background were the shadows of intercontinental missiles loaded with living hot agents, targeted on the United States and possibly Britain. The inspectors wanted to know this: have you people targeted my country with smallpox in missiles? What kind of smallpox? Both sides understood that the inspectors were looking straight into the asshole of modern military biology.

No answers were forthcoming. The explanations of the Russian biologists just got stranger and stranger. They said that they were working on clones of smallpox, not on smallpox itself. Genetic experiments in the West involving smallpox are done using clones of the vaccinia virus, because vaccinia is harmless to humans (it's the strain used for making the smallpox vaccine). To work on clones of smallpox is to work on recombinant smallpox. By insisting that they were working only on 'clones of smallpox' the Russians essentially admitted that they were doing black biology with smallpox. As to whether they created whole new strains of smallpox, or whether they worked on parts of the smallpox virus, the Russians would not say. Did they take pieces of smallpox and mix them into some other virus or into a bacterium for study? Did they engineer a vaccine-elusive smallpox? It was impossible to tell.

All of the words of the Soviet biologists were captured on tape recordings. Their statements were translated and retranslated by Russian-language experts. The words were analyzed to death by experts working for the National Security Agency and other intelligence agencies. In the end, as Littleberry put it, 'We never learned what the hell they did with smallpox.'

It should not be forgotten that these were military scientists. The goal of their research was military. They had tried and perhaps succeeded at making a genetically engineered smallpox. One participant in the confrontation between the — inspectors and the Russian military biologists believed that they had mixed pieces of brain viruses into smallpox, thus making a brainpox — a smallpox that attacks the human brain.

After the inspection teams returned from Russia, the C.I.A., British intelligence, and the National Security Agency collectively had a heart attack. A gulf had opened up between the factual knowledge of the eyewitness inspectors and the belief structure of the civilian science community. Senior scientists, especially in microbiology and molecular biology, began to get accelerated security clearances and were briefed on the situation, not only with regard to Russia but other countries as well. Scientists who attended these briefings came away shocked. 'Their eyes were like saucers,' according to one American scientist who was present at several such briefings. Biologists had discovered that one or more Manhattan bomb projects had occurred in their field, and they hadn't known about it or believed that such a thing was possible. What was particularly upsetting for some of them was the realization that leading members of their own profession had invented and were developing weapons that were in some ways significantly more powerful than the hydrogen bomb.

Matthew Meselson at Harvard was still insisting that the Biological Weapons Convention was not being violated. For years he had dominated the discussion of biological weapons, and his opinions had been widely accepted. He had published articles in prestigious journals supporting the view that the anthrax deaths in Sverdlovsk in 1979 had been caused by the citizens eating bad meat, and he offered detailed scientific data from Russian colleagues to support him. It seems that the creators of the biological weapons treaty had become its guardians, with too great a stake in the treaty's `success,' and this made them blind to Russian violations and to the reality of bio-weapons.

Russian news reporters began to investigate the Sverdlovsk accident, and in 1991, the Moscow bureau chief of The Wall Street journal, Peter Gumbel, made three trips to Sverdlovsk, and at some personal risk, while he was being followed and harassed by the K.G.B., traced about half of the civilian victims. He located their families, who had wrenching stories to tell; he found doctors who had treated the victims; he unearthed medical evidence; and he showed that most of the victims had lived or worked next to a military compound. Meselson had written that the anthrax came from a 'meat-processing plant at Aramil.' Gumbel went to Aramil and found no meat plant, only a picturesque village. He later confronted the Harvard professor with the fact that the meat plant didn't exist. He reported rather drily that 'Prof. Meselson seemed taken aback.'

Meselson found himself in an awkward position, to say the least. The Wall Street Journal's investigative reporting made it appear that the scientific data that he had published about Sverdlovsk was not only wrong but might have been fabricated by his Russian colleagues. Meselson had been both a victim and an unknowing disseminator of potentially misleading or even fraudulent scientific information. He got permission to go to Sverdlovsk, and with his wife Jeanne Guillemin and a team of collaborators, demonstrated that the outbreak really had been caused by an airborne release of anthrax from a military plant. He eventually published his findings in 1994 in the magazine Science. He did not, however, see fit to credit Peter Gumbel anywhere in his article.

He and his co-authors concluded that only a pinch of anthrax had been released into the air, not a large amount — only a minuscule whiff of anthrax that might be almost invisible if held between thumb and forefinger. Some experts disputed the notion that such a tiny amount of anthrax could kill so many people in a plume across a city. It is more logical, and it now seems widely accepted, that the amount of anthrax was more than a pinch, but no one really knows. The accident involved production of anthrax for weapons, and the story is that filters had been left off grinding machines, but the world may never learn what really happened.

The important thing is that Matthew Meselson had done an about-face. There is a world of difference between a pinch of weapon and a ton of bad meat. The other turnaround was more impressive, and it came from Russian president Boris Yeltsin, who confirmed to the world that modern Russia had inherited a biologicalweapons program from the Soviet Union. This information was corroborated and expanded upon by two more senior defectors from the Russian bioweapons program. 'Cop officials in the Russian program have just recently released a list of the hot agents that the modern Russian military forces would be most likely to use in the event of war. In order of choice, it goes: smallpox, Black Death, and anthrax. One or more of them may be genetically engineered. Biological-weapons treaty? What treaty?

Masaccio and Littleberry sat in silence for a while, as Masaccio took in the context in which the Cobra Event was being played out.

'The cancer has metastasized,' Littleberry said. 'A lot of countries are into biological weapons now. Syria has a top-notch biological-weapons program. Syria is also believed to be a sponsor of terrorism — you would know more about that than I do, Frank. If Syria's got a program, you can wonder if Israel has gone seriously into black biology, and Israeli scientists are some of the best in the world. Iran is heavily into biological weapons; they know all about molecular biology, and they are also testing cruise missiles. Think about that. Think about line streakouts of an engineered hot agent. China has massive biological-weapons facilities out in the Sinkiang desert, but it's hard for us to know what they're doing, because our satellites are useless for detecting bioweapons research. We can't see inside the buildings, and even if we could, we wouldn't know what was growing in the tanks. We do know that the Chinese are very good in the area of molecular biology. And that's not all. There are plenty of other countries that are developing bioweapons. None of these countries is that good. There are some clever idiots out there, and sooner or later, there is going to be a very serious biological accident. Something that will make Sverdlovsk look like a kiddie ride at the park. And I think it will be global, not just one city.'

Littleberry went on to say that he sometimes wondered if there had already been major accidents. 'The Gulf War Syndrome,' he said, 'is almost certainly caused by exposure to chemical weapons. But we have not yet totally ruled out the possibility that it's some kind of biological weapon. Maybe early in the war the Iraqis did a line laydown of some experimental agent that we never noticed. One jet flying along — we might not have recognized it as a laydown. It might mean that the Gulf War Syndrome could be contagious and spreading. I doubt it, but you never know. Now think about the AIDS virus. There's a lot of evidence that AIDS is a natural virus that comes from the Central African rain forests, but in fact the origin of AIDS is unknown. We cannot rule out the possibility that AIDS is a weapon. Is AIDS something that escaped from a weapons lab somewhere? I don't think so, but I keep wondering.'

'Is Cobra like that? Did it escape from somewhere, Mark?'

'I doubt it. Someone stole it from a lab, is my guess.' 'What about Russia? What's going on there now?' 'That's real touchy stuff. Real ugly. Real sensitive.' 'Of course,' Masaccio said. , 'There's a building at the Koltsovo Institute of Molecu lar Biology that doesn't have a name or a number,' Littleberry said. 'We nicknamed it Corpus Zero, and we demanded to be allowed to go inside.'

After a lot of hesitation, the Russian minders finally agreed to allow the inspectors to have a very brief tour of Corpus Zero. Since that time, no inspector from the

United States or anyplace else has been allowed back inside Corpus Zero. What is known about Corpus Zero is based on one brief visit in 1991.

Corpus Zero is situated in a corner of the Koltsovo campus. It is a large building, made of brick, with small windows, a building shaped like a cube.

'We didn't know what was going on inside Corpus Zero. The satellite imagery didn't show anything,' Littleberry said.

All of the Koltsovo staff had been sent home at the time of the inspection, so Corpus Zero was deserted when the inspection team entered with a group of minders. There wasn't much to see. The building appeared to contain only office space and normal biology labs. On one of the laboratory benches, an inspector discovered a piece of paper pinned to the side of the bench with a tack. On it was written in English, 'The eagle can't catch a fly.' It seemed to be a way of thumbing one's nose at the inspectors.

The inspectors were touring some offices when Littleberry told everyone that he was going to the men's room. As he was coming out of the men's room, he found that the team and the minders had gone down a hallway and were starting to turn a corner. He saw his chance. He went in the other direction.

Littleberry had gone AWOL.

Telling the story to Frank Masaccio, Littleberry found himself drifting back in time. The memory was so clear, set off in distinct edges from the foggy haze that followed.

The corridors in Corpus Zero were in the shape of a ring, he realized. All the corridors circled around the center of the building but did not give access to the center. There had to be something hidden in the center of Corpus Zero. The building must have a hot zone at its core.

How to reach the core? On the inside wall of a corridor, he found an unmarked steel door. It did not have a biohazard symbol on it. Littleberry opened it. He found himself in a corridor heading inward. The light was dim, and he turned on his flashlight.

It was a blank corridor. He kept going, and opened a far door. He found himself in a vast interior space. It was the center of Corpus Zero, and it was pitch-dark. He switched on his flashlight. He was standing in a hangarlike room, several stories tall. In the center sat an enormous steel cube. He played his flashlight over the cube. Sticking out of the cube in various places were probes and tubes — they were obviously sensor devices, monitoring devices. They were there to monitor something happening inside the cube.

He circled the cube, his footsteps echoing on the concrete floor, and he found a control room. There were computer consoles and all manner of gauges and controls. The room was deserted, the staff gone, the computers turned off.

Littleberry turned and faced the cube. That was when he saw the stairs. The stairs led halfway up the side of the cube to a door. The door had a circular wheel handle, like a pressure door in a submarine. His flashlight played over the door, and then he saw the symbol. The door was marked with a red biohazard flower.

The flower beckoned to Littleberry like his own fate. Fuck it, I'll hold my breath, he said to himself. When he arrived at the landing at the top of the stairs, he spun the wheel. Locks pulled back. He took a breath, opened the door, and shone his flashlight in.

He began to descend a stairway into the chamber. He knew what the chamber was. It was an explosion-test chamber. It was for testing small bioweapons in the air. The chamber is used to simulate a battlefield environment that has gone hot with a biological weapon.

He heard a whimpering sound. 'Hello?' he said.

There was no answer.

At the bottom of the chamber he found a passage leading off horizontally. He looked into it and pointed his flashlight around, and found the cages for the test animals. In one of the cages a female monkey sat crouched. He saw that she was a rhesus monkey. She reached toward him and drew her hand away.

'Sorry, sweetheart,' he said. 'I don't have any food.' He played his flashlight over the animal. Like all female primates, she had breasts for suckling her young. He saw that her nipples were leaking blood. Her body was peppered with a rash of black blood blisters, halfhidden in her fur. The blisters looked like garnets in the light of his flashlight. He saw pools of blood at the bottom of the animal's cage. She was hemorrhaging from the vagina. She was a simulated human female in a simulated biological war zone.

She gave an alarm cry, faint. Her teeth were covered with blood.

He had not held his breath. He turned and made his way back up the stairs. He had been inside an explosion test chamber at Koltsovo. This one was used for testing freeze-dried Ebola virus preparations that the Soviet Union was developing for missile warheads. The same chamber was also used for testing smallpox for warheads.

Three days after he walked into the Ebola chamber in Corpus Zero, Littleberry developed a fever and collapsed. He was rushed to the Koltsovo biocontainment hospital. It was a hospital with dozens of beds, behind steel airlock doors, where nurses and doctors wore space suits.

'I had airborne Ebola,' Littleberry said.

'Why aren't you dead?' Masaccio asked him.

'With a biological weapon, there will always be survivors. Maybe the Russian treatments worked on me. We still don't know.'

Mark Littleberry remained in the Koltsovo hospital for four weeks. The medical staff were embarrassed and deeply apologetic, and did their best to take care of him. 'What was it like, having that?' Masaccio asked.

'All I remember is the way I cursed those folks in space suits every time they tried to turn me over in bed.' 'One thing I've got to ask you, Dr Littleberry. Do we have a secret biological weapons program?' Littleberry stared at him. 'Jesus — you ought to know, Frank.'

'Well, I don't. The C.I.A. doesn't always tell me things.'

'There are two answers to your question,' Littleberry said. 'One, I personally have no evidence that the U.S. military has a secret bioweapons program. The second answer is, we could have it anytime we wanted. Our biotechnology industry is second to none.'

'So why don't we do it?' Masaccio asked.

'It would leak pretty quick. This is the world's leakiest government, and public opinion would stop it. I like to think so, anyway.'

The staff at the Koltsovo Institute of Molecular Biology numbered four thousand at the time of the first biologicalweapons inspection, in 1991. By 1997, after economic troubles had hit Russia, the staff at Koltsovo had shrunk to about two thousand. Two thousand scientists and staff members from Koltsovo no longer work there. Some of them have gone missing, and the Russian government itself does not seem to know where to find them. Some of them have left Russia. Some of them are working for bioweapons programs in other countries, probably in Iran and Syria, possibly in Iraq, and perhaps in Asian countries. What strains they took with them, and where they are now, is a question that bedevils intelligence agencies.

Biopreparat is broke and is trying to make money, any way it can, in order to keep its scientists and staff employed. The Russian government does not want its biological scientists leaving Russia, because they could carry their knowledge and military strains of viruses to a country that is an enemy of Russia. In Russia today, you can buy face cream made by Biopreparat. You can buy Biopreparat vodka. It is known as 'Siberian Sunshine.' Biopreparat scientists have told Americans that it is made in former anthrax tanks, and they don't seem to be joking. The vodka is probably safe to drink, for if Biopreparat knows anything, it knows how to sterilize a hot zone. Biopreparat is now a joint stock corporation. You can buy shares in Biopreparat on the Moscow stock exchange.

The Russian Ministry of Defense was always in control of the country's bioweapons-development work, and it also controlled the stockpiling and deployment of the weapons. The Ministry of Defense paid for the research done by Biopreparat, and used the fruits of the research in warheads. It is very difficult to find a knowledgeable expert who believes that Russia has given up developing offensive biological weapons. The program is probably smaller in scope, but it is believed to continue at secret locations, more deeply buried than before. Defense is still supremely important to Russia. As molecular biology becomes cheaper and easier to do, and as virusproduction facilities become smaller and more portable, a biological-weapons program can continue to move forward almost unnoticed. The fly becomes smaller, faster, harder to catch.

In recent visits to Koltsovo, American scientists have noticed that the lights are burning in the windows of Corpus Zero at three o'clock in the afternoon, when it begins to grow dark in Siberia during the fall and winter.

The lights are out almost everywhere else in Koltsovo, but they remain lit on all floors of the building with no name. The Russian managers of the site have said to American visitors that 'only three married couples work there, and they have had their smallpox vaccinations.' It is obvious that many more people than. that are employed at Corpus Zero. What the staff is doing with the Ebola-smallpox aerosol test chamber inside Corpus Zero is unknown. Who is paying for the research being done in Corpus Zero and what type of research is being done there are unknown.

'Biopreparat was a Humpty Dumpty,' Littleberry told Masaccio. 'It fell and broke when the Soviet Union broke. Biopreparat has gone into pieces that have fallen in different directions. The Biopreparat that's visible is the part that makes face cream and vodka. Another chunk was pulled into the Russian military. There may be other invisible pieces of Biopreparat floating around. Dangerous fragments. Maybe Biopreparat has an Evil Child. Maybe the Evil Child has no connection to Russia anymore.'

'So you think an Evil Child has put together the Cobra virus?' Masaccio said, incredulously. 'You think it's the Russians?'

Littleberry smiled. 'Not exactly. This Cobra virus is so beautiful and so new that it has to be American engineering, Frank. Has to be. Looking at that virus is like looking at a starship. But the smallpox in it — that's ancient and old and smells like Russia. Will Hopkins keeps talking about reaching through Cobra to find its maker. Here's what I think. I think Cobra has two makers. One is American and one is Russian. They've gotten together somehow, and there's money involved. There has to be. I think there's a company in this. Cobra does comes from an Evil Child. And I think the Evil Child is an American company that is operating somewhere near New York City.'