Shadows of Forgotten Ancestors was selected by School Library Journal as one of nine “best books of the year” out of 40,000 titles: “The enchanting writing style captivates … a clarity that will hold the interest of the most science-phobic reader.”
“A funhouse maze of biology, psychology, evolution, fact, theory, probability, possibility, and awe … Warning Those who regard the human condition as the inviolable perch at the top of the evolutionary heap, the gold watch at the end of the great chain of being, will find much in Shadows that disturbs.”
—Miami Herald
“In this book Carl Sagan and Ann Druyan illuminate some of the most daunting questions of our time, and any time, sometimes explaining them straight out, sometimes challenging the reader to contemplate the truths we hold dear. Shadows is one of those rare books that should be required reading.”
—New Orleans Times-Picayune
“Jam-packed with fascinating anecdotes, a playful wit and humor, a wide-ranging command of relevant scientific data, and (a warning to readers who are easily scandalized), an ‘indecorous explicitness on matters sexual.’ ”
—Nashville Banner
“Superb.”
—Tom Peters
Chicago Tribune
“Their latest literary wonder.”
—New York Times Syndicate
“It has been a long time since I came across a nonfiction book as compelling as this one. At times I found myself impatiently turning pages, as if I were reading a murder mystery and couldn’t wait to discover the ending.”
—Corpus Christi Caller-Times
“An eloquent attempt to place the human species in context … They use the same compelling style that made Cosmos such an international success.… It is a big story. Indeed, it is the biggest story.”
—Worcester (Massachusetts) Telegram
“A coherent, moving story … Philosophical, poetic, even witty, [with] a sense of almost religious awe.”
—Book Page
“Excellent … An important book that deserves to be widely read and discussed.”
—Monroe Strickberger
Author of the textbook Evolution,
writing in the San Francisco Examiner-Chronicle
“Formidably intelligent and well-informed.”
—Chicago Sun Times
“Hauntingly appealing. Carl Sagan is probably the best literary stylist American science has produced since Loren Eiseley and Lewis Thomas.”
—The Observer (London)
“Informative, enlightening, and refreshingly unacademic.”
—Atlanta Journal & Constitution
“It is easy to hear his familiar voice guiding the reader through time and the early rumblings of the universe through the development of DNA, evolution, and the rise of modern primates.”
—Gannett News Service
“Sagan’s contribution to increasing public understanding of science and making provocative connections between different areas are at the highest level of benefit to our society.”
—John Bahcall
Institute for Advanced Study Princeton, NJ
“It has sex. It has humor. It has drama. It’s what people go to the movies for.”
—Steve Knight
KIEV-AM, Los Angeles
“They go boldly where many scientists have feared to tread … And what a journey it is!”
—Phoenix (Arizona) Gazette
“Eloquent … Visionary … Powerfully imagined.”
—Booklist
“Engaging … Lyrical … Stunning.”
—Publishers Weekly
ALSO BY CARL SAGAN AND ANN DRUYAN
Comet
Murmurs of Earth (with others)
SOME OTHER BOOKS BY CARL SAGAN
Intelligent Life in the Universe (with I. S. Shklovskii)
The Cosmic Connection
The Dragons of Eden
Brocas Brain
Cosmos
Contact
A Path Where No Man Thought (with Richard Turco)
ALSO BY ANN DRUYAN
A Famous Broken Heart
A carving from the Sepik River, central highlands of Papua New Guinea.
A Ballantine Book
Published by The Random House Publishing Group
Copyright © 1992 by Carl Sagan and Ann Druyan
All rights reserved under International and Pan-American Copyright Conventions Published in the United States by Ballantine Books, an imprint of The Random House Publishing Group, a division of Random House, Inc, New York, and simultaneously in Canada by Random House of Canada Limited, Toronto
This edition published by arrangement with Random House, Inc
Permissions acknowledgments for previously published
material can be found on this page
Library of Congress Catalog Card Number: 93-90012
Ballantine and colophon are registered trademarks of Random House, Inc
www.ballantinebooks.com
eISBN: 978-0-307-80103-6
v3.1
TO
LESTER GRINSPOON,
WHOSE EXAMPLE REASSURES US
THAT OUR SPECIES
MAY HAVE
WHAT IT TAKES
Thus she spoke; and I longed
to embrace my dead mother’s ghost.
Thrice I tried to clasp her
image, and thrice it slipped
through my hands, like a
shadow, like a dream.
HOMER
The Odyssey
Contents
CoverOther Books by This AuthorTitle PageCopyrightDedicationEpigraphIntroductionPrologue: The Orphan’s File
1 On Earth as It Is in Heaven
2 Snowflakes Fallen on the Hearth
3 “What Makest Thou?”
4 A Gospel of Dirt
5 Life Is Just a Three-Letter Word
6 Us and Them
7 When Fire Was New
8 Sex and Death
9 What Thin Partitions …
10 The Next-to-Last Remedy
11 Dominance and Submission
12 The Rape of Caenis
13 The Ocean of Becoming
14 Gangland
15 Mortifying Reflections
16 Lives of the Apes
17 Admonishing the Conqueror
18 The Archimedes of the Macaques
19 What Is Human?
20 The Animal Within
21 Shadows of Forgotten AncestorsEpilogueNotesPermissions AcknowledgmentsThe Authors
Introduction
We were very lucky. We were raised by parents who took seriously their responsibility to be strong links in the chain of generations. The search that informs this book may be said to have begun in childhood, when we were given unconditional love and protection in the face of real adversity. It’s an ancient practice of the mammals. It was never easy. In modern human society, it’s even harder. There are so many dangers now, so many of them unprecedented.
The book itself began in the early 1980’s when the rivalry between the United States and the Soviet Union was making a potentially fateful intersection with 60,000 nuclear weapons that had been accumulated for reasons of deterrence, coercion, pride, and fear. Each nation praised itself and vilified its adversaries, who were sometimes portrayed as less than human. The United States spent ten trillion dollars on the Cold War—enough to buy everything in the country except the land. Meanwhile, the infrastructure was collapsing, the environment was deteriorating, the democratic process was being subverted, injustice festered, and the nation was converted from the leading lender to the leading debtor on the planet. How did we get into this mess? we asked ourselves. How can we get out? Can we get out?
So we embarked on a study of the political and emotional roots of the nuclear arms race—which led us back to World War II, which of course had its origins in World War I, which was a consequence of the rise of the nation-state, which traces straight back to the very beginnings of civilization, which was a by-product of the invention of agriculture and the domestication of animals, which crystallized out of a very long period in which we humans were hunters and foragers. There was no sharp division along the way, no point at which we could say: Here are the roots of our predicament. Before we knew it, we were looking to the first humans and their predecessors. Events of remote ages, long before humans came to be, are critical, we concluded, for an understanding of the trap that our species seems to be setting for itself.
We resolved to look inside ourselves, to retrace as many of the important twists and turns of the evolution of our species as we were able. We made a compact with each other not to turn back, no matter where the search might lead. We had learned much from each other over the years, but our own politics are not identical. There was a chance that one or both of us might have to give up some of those beliefs we considered self-defining. But if we were successful, even in part, perhaps we could understand much more than just nationalism, the nuclear arms race, and the Cold War.
As we complete this book, the Cold War is over. But somehow we are not home free. New dangers edge their way onto center stage, and old familiar ones reassert themselves. We are confronted with a witches’ brew of ethnic violence, resurgent nationalism, inept leaders, inadequate education, dysfunctional families, environmental decay, species extinctions, burgeoning population, and increasing millions with nothing to lose. The need to understand how we got into this mess and how to get out seems more urgent than ever.
This book addresses the deep past, the most formative steps in our origins. Later, we will gather up the threads laid down here. We have been led to the writings of those who preceded us in this search, to distant epochs and other worlds and across a multitude of disciplines. We tried to keep in mind the physicist Niels Bohr’s aphorism, “Clarity through breadth.” The breadth required can be a little daunting, though. Humans have erected high walls separating the branches of knowledge essential to this quest—the various sciences, politics, religions, ethics. We have searched for low doors in the walls, or sometimes tried to vault over or burrow under. We feel a need to apologize for our limitations. We are well aware of the inadequacies of our knowledge and of our discernment. And yet such a search has no chance of succeeding unless those walls are breached. We hope that where we have failed, others will be inspired (or provoked) to do better.
What we are about to say draws on the findings of many sciences. We urge the reader to bear in mind the imperfection of our current knowledge. Science is never finished. It proceeds by successive approximations, edging closer and closer to a complete and accurate understanding of Nature, but it is never fully there. From the fact that so many major discoveries have been made in the last century—even in the last decade—it is clear that we still have far to go. Science is always subject to debate, correction, refinement, agonizing reappraisals, and revolutionary insights. Nevertheless, there now seems to be enough known to reconstruct some of the key steps that led to us and helped to make us who we are.
On our journey we encountered many who were generous with their time, expertise, wisdom, and encouragement, many who carefully and critically read all or part of the manuscript. As a result, deficiencies were removed, and errors of fact or interpretation corrected. We particularly thank Diane Ackerman; Christopher Chyba, Ames Research Center, NASA; Jonathan Cott; James F. Crow, Department of Genetics, University of Wisconsin, Madison; Richard Dawkins, Department of Zoology, Oxford University; Irven de Vore, Department of Anthropology, Harvard University; Frans B. M. de Waal, Department of Psychology, Emory University, and Yerkes Primate Research Center; James M. Dabbs, Jr., Department of Psychology, Georgia State University; Stephen Emlen, Section of Neurobiology and Behavior, Cornell University; Morris Goodman, Department of Anatomy and Cell Biology, Wayne State University School of Medicine; Stephen Jay Gould, Museum of Comparative Zoology, Harvard University; James L. Gould and Carol Grant Gould, Department of Biology, Princeton University; Lester Grinspoon, Department of Psychiatry, Harvard Medical School; Howard E. Gruber, Department of Developmental Psychology, Columbia University, Jon Lomberg; Nancy Palmer, Shorenstein Barone Center on the Press and Politics, Kennedy School of Government, Harvard University; Lynda Obst; William Provine, Departments of Genetics and of the History of Science, Cornell University; Duane M. Rumbaugh and E. Sue Savage-Rumbaugh, Language Research Center, Georgia State University; Dorion, Jeremy, and Nicholas Sagan; J. William Schopf, Center for the Study of Evolution and the Origin of Life, University of California, Los Angeles; Morty Sills; Steven Soter, Smithsonian Institution; Jeremy Stone, Federation of American Scientists; and Paul West. Many scientists kindly sent us pre-publication copies of their work. C.S. also thanks his early teachers in the life sciences, H. J. Muller, Sewall Wright, and Joshua Lederberg. Of course none of these people are responsible for any remaining errors.
We are deeply grateful to those who ushered this work through its various drafts. For excellence in library research, transcription, file keeping, and much else we owe a special debt of gratitude to A.D.’s assistant, Karenn Gobrecht, and to C.S.’s long-time Administrative Assistant at Cornell, Eleanor York. We also thank Nancy Birn Struckman, Dolores Higareda, Michelle Lane, Loren Mooney, Graham Parks, Deborah Pearlstein, and John P. Wolff. The superb facilities of the Cornell University library system were a critical resource in the writing of this book. We also could not have written it without the help of Maria Farge, Julia Ford Diamond, Lisbeth Collacchi, Mamie Jones, and Leona Cummings.
We are indebted to Scott Meredith and Jack Scovil of the Scott Meredith Literary Agency for unstinting encouragement and support. We are happy that Shadows has come to fruition during Ann Godoff’s tenure as our editor; and also thank Harry Evans, Joni Evans, Nancy Inglis, Jim Lambert, Carol Schneider, and Sam Vaughan at Random House.
Walter Anderson, the editor-in-chief of Parade magazine, has made it possible for us to present our ideas to the broadest possible audience. Working with him and Senior Editor David Currier has been an unalloyed pleasure.
This book is written for a wide readership. For clarity, we have sometimes stressed the same point more than once, or in more than one context. We have tried to indicate qualifications and exceptions. The pronoun “we” is used sometimes to mean the authors of this book, but usually to mean the human species; the context should make clear which is meant. For those who wish to dig deeper, references to other works, popular and technical—keyed to superscripts in the text—are in the back of the book. Also to be found there are additional comments, notes, and clarifications. Although the two works have little else in common, the haunting 1964 film by Sergei Parajanov gave us our title.
As for essential inspiration and a heightened sense of urgency, it was during the years of preparation of this book that we became the parents of Alexandra Rachel and Samuel Democritus—beloved namesakes of unforgettable ancestors.
CARL SAGAN
ANN DRUYAN
June 1, 1992
Ithaca, N.Y.
Prologue
THE
ORPHAN’S
FILE
Having seen a small part of life, swift to die,
men rise and fly away like smoke, persuaded
only of what each has met with … Who then
claims to find the whole?
EMPEDOCLES
On Nature1
Who are we? The answer to this question is not
only one of the tasks, but the task of science.
ERWIN SCHRÖDINGER
Science and Humanism2
The immense, overpowering blackness is relieved here and there by a faint point of light—which, upon closer approach, is revealed to be a mighty sun, blazing with thermonuclear fire and warming a small surrounding volume of space. The Universe is, almost entirely, black emptiness, and yet the number of suns is staggering. The neighborhoods immediately encompassing these suns represent an insignificant fraction of the vastness of the Cosmos, but many, perhaps most, of those cheerful, bright, clement circumstellar regions are occupied by worlds. In the Milky Way galaxy alone there may be a hundred billion of them—neither too close by, nor too distant from, the local sun, around which they orbit in silent gravitational homage.
This is a story about one such world, perhaps not very different from many others—a story, especially, about the beings that evolved upon it, and one kind in particular.
Just to be alive billions of years after the origin of life, a being must be tough, resourceful, and lucky: There have been so many hazards along the way. Lifeforms endure by being patient, say, or ravenous, or solitary and camouflaged, or profligate with offspring, or fearsome hunters, or able to fly away to safety, or sleek swimmers, or burrowers, or sprayers of noxious, disorienting liquids, or masters at infiltrating into the very genetic material of other, unsuspecting, beings; or by accidentally being elsewhere when the predators stalk or the river is poisoned or the food supply dwindles. The creatures with which we are particularly concerned were, not so long ago, gregarious to a fault, noisy, quarrelsome, arboreal, bossy, sexy, clever, tool-using, with prolonged childhoods and tender regard for their young. One thing led to another, and in a twinkling their descendants had multiplied all over the planet, killed off all their rivals, devised world-transforming technologies, and posed a mortal danger to themselves and the many other beings with whom they shared their small home. At the same time, they set off to visit the planets and the stars.
——
Who are we? Where do we come from? Why are we this way and not some other? What does it mean to be human? Are we capable, if need be, of fundamental change, or do the dead hands of forgotten ancestors impel us in some direction, indiscriminately for good or ill, and beyond our control? Can we alter our character? Can we improve our societies? Can we leave our children a world better than the one that was left to us? Can we free them from the demons that torment us and haunt our civilization? In the long run, are we wise enough to know what changes to make? Can we be trusted with our own future?
Many thoughtful people fear that our problems have become too big for us, that we are for reasons at the heart of human nature unable to deal with them, that we have lost our way, that the dominant political and religious ideologies are unable to halt an ominous, long-term drift in human affairs—indeed, that they have helped cause that drift through rigidity, incompetence, and the inevitable corruption of power. Is this true, and if it is, can we do anything about it?
In attempting to understand who we are, every human culture has invented a corpus of myth. The contradictions within us are ascribed to a struggle between contending but equally matched deities; or to an imperfect Creator; or, paradoxically, to a rebellious angel and the Almighty; or to the even more unequal struggle between an omnipotent being and disobedient humans. There have also been those who hold that the gods have nothing to do with it. One of them, Nanrei Kobori, late Abbot of the Temple of the Shining Dragon, a Buddhist sanctuary in Kyoto, said to usGod is an invention of Man. So the nature of God is only a shallow mystery. The deep mystery is the nature of Man.
Had life and humans first come to be hundreds or even thousands of years ago, we might know most of what’s important about our past. There might be very little of significance about our history that’s hidden from us. Our reach might extend easily to the beginning. But instead, our species is hundreds of thousands of years old, the genus Homo millions of years old, primates tens of millions of years old, mammals over 200 million years old, and life about 4 billion years old. Our written records carry us only a millionth of the way back to the origin of life. Our beginnings, the key events in our early development, are not readily accessible to us. No firsthand accounts have come down to us. They cannot be found in living memory or in the annals of our species. Our time-depth is pathetically, disturbingly shallow. The overwhelming majority of our ancestors are wholly unknown to us They have no names, no faces, no foibles. No family anecdotes attach to them. They are unreclaimable, lost to us forever. We don’t know them from Adam. If an ancestor of yours of a hundred generations ago—never mind a thousand or ten thousand—came up to you on the street with open arms, or just tapped you on the shoulder, would you return the greeting? Would you call the authorities?
We ourselves, the writers of this book, have so short a reach into our family histories that we can peer clearly only two generations back, dimly three, and almost not at all beyond that. We do not know even the names—much less the occupations, countries of origin, or personal histories—of our great-great-grandparents. Most people on Earth, we think, are similarly isolated in time. For most of us, no records have preserved the memories of our ancestors of even a few generations back.
A vast chain of beings, human and nonhuman, connects each of us with our earliest predecessors Only the most recent links are illuminated by the feeble searchlight of living memory. All the others are plunged into varying degrees of darkness, more impenetrable the farther from us they are in time. Even those fortunate families who have managed to keep meticulous records range no more than a few dozen generations into the past. And yet a hundred thousand generations ago our ancestors were still recognizably human, and ages of geological time stretch back before them. For most of us, the searchlight progresses forward as the generations do, and as the new ones are born, information about the old ones is lost. We are cut off from our past, separated from our origins, not through some amnesia or lobotomy, but because of the brevity of our lives and the immense, unfathomed vistas of time that separate us from our coming to be.
We humans are like a newborn baby left on a doorstep, with no note explaining who it is, where it came from, what hereditary cargo of attributes and disabilities it might be carrying, or who its antecedents might be. We long to see the orphan’s file.
Repeatedly, in many cultures, we invented reassuring fantasies about our parents—about how much they loved us, about how heroic and larger than life they were.3 As orphans do, we sometimes blamed ourselves for having been abandoned. It must have been our fault. We were too sinful, perhaps, or morally incorrigible. Insecure, we clung to these stories, imposing the strictest penalties on any who dared to doubt them. It was better than nothing, better than admitting our ignorance of our own origins, better than acknowledging that we had been left naked and helpless, a foundling on a doorstep.
As the infant is said to feel it is the center of its Universe, so we were once sure, not just of our central position, but that the Universe was made for us. This old, comfortable conceit, this safe view of the world has been crumbling for five centuries. The more we understood of how the world is put together, the less we needed to invoke a God or gods, and the more remote in time and causality any divine intervention had to be. The cost of coming of age is giving up the security blanket. Adolescence is a roller coaster ride.
When, beginning in 1859, our very origins, it was suggested, could be understood by a natural, unmystical process—requiring no God or gods—our aching sense of isolation became nearly complete. In the words of the anthropologist Robert Redfield, the Universe began to “lose its moral character” and became “indifferent, a system uncaring of man.”4
Moreover, without a God or gods and the attendant threat of divine punishment, will not humans be as beasts? Dostoyevsky warned that those who reject religion, however well-intentioned they may be, “will end by drenching the earth with blood.”5 Others have noted that drenching has been in progress since the dawn of civilization—and often in the name of religion.
The distasteful prospect of an indifferent Universe—or worse, a meaningless Universe—has generated fear, denial, ennui, and the sense that science is an instrument of alienation. The cold truths of our scientific age are uncongenial to many. We feel stranded and alone. We crave a purpose to give meaning to our existence. We do not want to hear that the world was not made for us. We are unimpressed with moral codes contrived by mere mortals; we want one handed down from on high. We are reluctant to acknowledge our relatives. They are strangers to us still. We feel ashamed: After imagining our Antecedent as King of the Universe, we are now asked to accept that we come from the lowest of the low—mud, and slime, and mindless beings too small to be seen with the naked eye.
Why concentrate on the past? Why upset ourselves with painful analogies between humans and beasts? Why not simply look to the future? These questions have an answer. If we do not know what we’re capable of—and not just a few celebrity saints and notorious war criminals—then we do not know what to watch out for, which human propensities to encourage, and which to guard against. Then we haven’t a clue about which proposed courses of human action are realistic, and which are impractical and dangerous sentimentality. The philosopher Mary Midgley writes,Knowing that I have a naturally bad temper does not make me lose it On the contrary, it should help me to keep it, by forcing me to distinguish my normal peevishness from moral indignation My freedom, therefore, does not seem to be particularly threatened by the admission, nor by any light cast on the meaning of my bad temper by comparison with animals
The study of the history of life, the evolutionary process, and the nature of the other beings who ride this planet with us has begun to cast a little light on those past links in the chain. We have not met our forgotten ancestors, but we begin to sense their presence in the dark. We recognize their shadows here and there. They were once as real as we are. We would not be here if not for them. Our natures and theirs are indissolubly linked despite the aeons that may separate us. The key to who we are is waiting in those shadows.
——
When we began this search into our origins, using the methods and findings of science, it was almost with a sense of dread. We were afraid of what we might find. We found instead not just room but reason for hope, as we begin to explain in this book.
The real orphan’s file is long. We humans have uncovered bits and pieces, occasionally a few consecutive pages, nothing as elaborate as a complete chapter. Many of the words are blurred Most have been lost.7
Here then is one version of some of the early pages of the orphan’s file, the missing note that should have accompanied the foundling on the doorstep, something of our beginnings and the forgotten ancestors that are central to the outcome of our story. Like most family stories, it begins in the dark—so long ago and far away, in circumstances so unpromising, that no one could have guessed where it all would lead.
We are about to trace the history of life, and the path that led to us—how we got to be the way we are. It is fitting that we begin at the beginning. Or a little earlier.
Chapter 1
ON EARTH AS IT IS IN HEAVEN
How long the stars
Have been fading,
Lamplight dimming …
NANSEN
(748–834, China)1
For the forming of the earth they said “Earth.” It arose suddenly, just like a cloud, like a mist, now forming, unfolding …
Popol Vuh: The Mayan Book of the Dawn of Life2
Nothing lives forever, in Heaven as it is on Earth. Even the stars grow old, decay, and die. They die, and they are born. There was once a time before the Sun and Earth existed, a time before there was day or night, long, long before there was anyone to record the Beginning for those who might come after.
Nevertheless, imagine you were a witness to that time:
An immense mass of gas and dust is swiftly collapsing under its own weight, spinning ever faster, transforming itself from a turbulent, chaotic cloud into what seems to be a distinct, orderly, thin disk. Its exact center smolders a dull, cherry red. Watch from on high, above the disk, for a hundred million years and you will see the central mass grow whiter and more brilliant, until, after a couple of abortive and incomplete attempts, it bursts into radiance, a sustained thermonuclear fire. The Sun is born. Faithfully, it will shine over the next five billion years—when the matter in the disk will have evolved into beings able to reconstruct the circumstances of its origin, and theirs.
Only the innermost provinces of the disk are illuminated. Farther out, the sunlight fails to penetrate. You plunge into the recesses of the cloud to see what wonders are unfolding. You discover a million small worlds milling about the great central fire. A few thousand sizable ones here and there, most circling near the Sun but some at great distances away, are destined to find each other, merge, and become the Earth.
This spinning disk out of which worlds are forming has fallen together from the sparse matter that punctuates a vast region of interstellar vacuum within the Milky Way galaxy. The atoms and grains that make it up are the flotsam and jetsam of galactic evolution—here, an oxygen atom generated from helium in the interior inferno of some long-dead red giant star; there, a carbon atom expelled from the atmosphere of a carbon-rich star in some quite different galactic sector; and now an iron atom freed for world-making by a mighty supernova explosion in the still more ancient past. Five billion years after the events we are describing, these very atoms may be coursing through your bloodstream.
Our story begins here in the dark, pullulating, dimly illuminated disk: the story as it actually turned out, and an enormous number of other stories that would have come to be had things gone just a little differently; the story of our world and species, but also the story of many other worlds and lifeforms destined never to be. The disk is rippling with possible futures.3
——
For most of their lives, stars shine by transmuting hydrogen into helium. It happens at enormous pressures and temperatures deep inside them. Stars have been aborning in the Milky Way galaxy for ten billion years or more—within great clouds of gas and dust. Almost all the placenta of gas and dust that once surrounded and nourished a star is quickly lost, either devoured by its tenant or spewed back into interstellar space. When they are a little older—but we are still talking about the childhood of the stars—a massive disk of gas and dust can be discerned, the inner lanes circling the star swiftly, the outer ones moving more stately and slowly. Similar disks are detectable around stars barely out of their adolescence, but now only as thin remnants of their former selves—mostly dust with almost no gas, every grain of dust a miniature planet orbiting the central star. In some of them, dark lanes, free of dust, can be made out. Perhaps half the young stars in the sky that are about as massive as the Sun have such disks. Still older stars have nothing of the sort, or at least nothing that we are yet able to detect. Our own Solar System to this day retains a very diffuse band of dust orbiting the Sun, called the zodiacal cloud, a wispy remake of the great disk from which the planets were born.
The story these observations are telling us is this: Stars formed in batches from huge clouds of gas and dust. A dense clump of material attracts adjacent gas and dust, grows larger and more massive, more efficiently draws matter to it, and is off on its way to stardom. When the temperatures and pressures in its interior become high enough, hydrogen atoms—the most abundant material in the Universe by far—rare jammed together and thermonuclear reactions are initiated. When it happens on a large enough scale, the star turns on and the nearby darkness is dispelled. Matter is turned into light.
The collapsing cloud spins up, squashes down into a disk, and lumps of matter aggregate together—successively the size of smoke particles, sand grains, rocks, boulders, mountains, and worldlets. Then the cloud tidies itself up through the simple expedient of the largest objects gravitationally consuming the debris. The dust-free lanes are the feeding zones of young planets. As the central star begins to shine, it also sends forth great gales of hydrogen that blow grains back into the void. Perhaps some other system of worlds, fated to arise billions of years later in some distant province of the Milky Way, will put these rejected building blocks to good use.
In the disks of gas and dust that surround many nearby stars, we think we see the nurseries in which worlds, far-off and exotic, are accumulating and coalescing. All over our galaxy, vast, irregular, lumpy, pitch-black, interstellar clouds are collapsing under their own gravity, and spawning stars and planets. It happens about once a month. In the observable Universe—containing as many as a hundred billion galaxies—perhaps a hundred solar systems are forming every second. In that multitude of worlds, many will be barren and desolate. Others may be lush and fertile, on which beings exquisitely adapted to their several circumstances are growing up, coming of age, and attempting to piece together their beginnings. The Universe is lavish beyond imagining.
——
As the dust settles and the disk thins, you can now make out what is happening down there. Hurtling about the Sun is a vast array of worldlets, all in slightly different orbits. Patiently you watch. Ages pass. With so many bodies moving so quickly, it is only a matter of time before worlds collide. As you look more closely, you can see collisions occurring almost everywhere. The Solar System begins amid almost unimaginable violence. Sometimes the collision is fast and head-on, and a devastating, although silent, explosion leaves nothing but shards and fragments. At other times—when two worldlets are in nearly identical orbits with nearly identical speeds—the collisions are nudging, gentle; the bodies stick together, and a bigger, double worldlet emerges.
In another age or two, you notice that several much larger bodies are growing—worlds that, by luck, escaped a disintegrating collision in their early, more vulnerable days. Such bodies—each established in its own feeding zone—plow through the smaller worldlets and gobble them up. They have grown so large that their gravity has crushed out the irregularities; these bigger worlds are nearly perfect spheres. When a worldlet approaches a more massive body, although not close enough to collide, it swerves; its orbit is changed. On its new trajectory, it may impact some other body, perhaps smashing it to smithereens; or meet a fiery death as it falls into the young Sun, which is consuming the matter in its vicinity; or be gravitationally ejected into the frigid interstellar dark. Only a few are in fortunate orbits, neither eaten, nor pulverized, nor fried, nor exiled. They continue to grow.
Beyond a certain mass, the bigger worlds are attracting not just dust, but great streams of interplanetary gas as well. You watch them develop, eventually each with a vast atmosphere of hydrogen and helium gas surrounding a core of rock and metal. They become the four giant planets, Jupiter, Saturn, Uranus, and Neptune. You can see the characteristic banded cloud patterns emerge. Collisions of comets with their moons splay out elegant, patterned, iridescent, ephemeral rings. Pieces of an exploded world fall back together, generating a jumbled, odd-lot, motley new moon. As you watch, an Earth-sized body plows into Uranus, knocking the planet over on its side, so once each orbit its poles point straight at the distant Sun.
Closer in, where the disk gas has by now been cleaned away, some of the worlds are becoming Earth-like planets, another class of survivors in this game of world-annihilating gravitational roulette. The final accumulation of the terrestrial planets takes no more than 100 million years, about as long compared to the lifespan of the Solar System as the first nine months is relative to the lifetime of an average human being. A doughnut-shaped zone of millions of rocky, metallic, and organic worldlets, the asteroid belt, survives. Trillions of icy worldlets, the comets, slowly orbit the Sun in the darkness beyond the outermost planet.
The principal bodies of the Solar System have now formed. Sunlight pours through a transparent, nearly dust-free interplanetary space, warming and illuminating the worlds. They continue to course and careen about the Sun. But look more closely still and you can make out that further change is being worked.
None of these worlds, you remind yourself, has volition; none intends to be in a particular orbit. But those that are on well-behaved, circular orbits tend to grow and prosper, while those on giddy, wild, eccentric, or recklessly tilted orbits tend to be removed. As time goes on, the confusion and chaos of the early Solar System slowly settle down into a steadily more orderly, simple, regularly spaced, and, to your eyes, increasingly beautiful set of trajectories. Some bodies are selected to survive, others to be annihilated or exiled. This selection of worlds occurs through the operation of a few extremely simple laws of motion and gravity. Despite the good neighbor policy of the well-mannered worlds, you can occasionally make out a flagrant rogue worldlet on collision trajectory. Even a body with the most circumspect circular orbit has no warrantee against utter annihilation. To continue to survive, an Earth-like world must also continue to be lucky.
The role of something close to random chance in all this is striking. Which worldlet will be shattered or ejected, and which will safely grow to planethood, is not obvious. There are so many objects in so complicated a set of mutual interactions that it is very hard to tell—just by looking at the initial configuration of gas and dust, or even after the planets have mainly formed—what the final distribution of worlds will be. Perhaps some other, sufficiently advanced observer could figure it out and predict its future—or even set it all in motion so that, billions of years later, through some intricate and subtle sequence of processes, a desired outcome will slowly emerge. But that is not yet for humans.
You started with a chaotic, irregular cloud of gas and dust, tumbling and contracting in the interstellar night. You ended with an elegant, jewel-like solar system, brightly illuminated, the individual planets neatly spaced out one from another, everything running like clockwork. The planets are nicely separated, you realize, because those that aren’t are gone.
——
It’s easy to see why some of those early physicists who first penetrated the reality of the nonintersecting, coplanar orbits of the planets thought that the hand of a Creator was discernible. They were unable to conceive of any alternative hypothesis that could account for such magnificent precision and order. But in the light of modern understanding, there is no sign of divine guidance here, or at least nothing beyond physics and chemistry. Instead we see evidence of a time of remorseless and sustained violence, when vastly more worlds were destroyed than preserved. Today we understand something of how the exquisite precision that the Solar System now exhibits was extracted from the disorder of an evolving interstellar cloud by laws of Nature that we are able to grasp—motion, and gravitation, and fluid dynamics, and physical chemistry. The continued operation of a mindless selective process can convert chaos into order.
Our Earth was born in such circumstances about 4.5 or 4.6 billion years ago, a little world of rock and metal, third from the Sun. But we musn’t think of it as placidly emerging into sunlight from its catastrophic origins. There was no moment in which collisions of small worlds with the Earth ceased entirely. Even today objects from space run into the Earth or the Earth overtakes them. Our planet displays unmistakable impact scars from recent collisions with asteroids and comets. But the Earth has machinery that fills in or covers over these blemishes—running water, lava flows, mountain building, plate tectonics. The very ancient craters have vanished. The Moon, though, wears no makeup. When we look there, or to the Southern Highlands of Mars, or to the moons of the outer planets, we find a myriad of impact craters, piled one on top of the other, the record of catastrophes of ages past. Since we humans have returned pieces of the Moon to the Earth and determined their antiquity, it is now possible to reconstruct the chronology of cratering and glimpse the collisional drama that once sculpted the Solar System. Not just occasional small impacts, but massive, stupefying, apocalyptic collisions is the inescapable conclusion from the record preserved on the surfaces of nearby worlds.
By now, in the Sun’s middle age, this part of the Solar System has been swept free of almost all the rogue worldlets. There is a handful of small asteroids that come near the Earth, but the chance that any of the bigger ones will hit our planet soon is small. A few comets visit our part of the Solar System from their distant homeland. Out there, they are occasionally jostled by a passing star or a nearby, massive interstellar cloud—and a shower of icy worldlets comes careening into the inner Solar System. These days, though, big comets hit the Earth very rarely.
Shortly, we will sharpen our focus to one world only, the Earth. We will examine the evolution of its atmosphere, surface, and interior, and the steps that led to life and animals and us. Our focus will then progressively narrow, and it will be easy to think of us as isolated from the Cosmos, a self-sufficient world minding its own business. In fact, the history and fate of our planet and the beings upon it have been profoundly, crucially influenced, through the whole history of the Earth and not just in the time of its origins, by what’s out there. Our oceans, our climate, the building blocks of life, biological mutation, massive extinctions of species, the pace and timing of the evolution of life, all cannot be understood if we imagine the Earth hermetically sealed from the rest of the Universe, with only a little sunlight trickling in from the outside.
The matter that makes up our world came together in the skies. Enormous quantities of organic matter fell to Earth, or were generated by sunlight, setting the stage for the origin of life. Once begun, life mutated and adapted to a changing environment, partially driven by radiation and collisions from outside. Today, nearly all life on Earth runs off energy harvested from the nearest star. Out there and down here are not separate compartments. Indeed, every atom that is down here was once out there.5
Not all of our ancestors made the same sharp distinction we do between the Earth and the sky. Some recognized the connection. The grandparents of the Olympian gods and therefore the ancestors of humans were, in the myths of the ancient Greeks, Uranus,6 god of the sky, and his wife Gaia, goddess of the Earth. Ancient Mesopotamian religions had the same idea. In dynastic Egypt the gender roles were reversed: Nut was goddess of the sky, and Geb god of Earth. The chief gods of the Konyak Nagas on the Himalayan frontier of India today are called Gawang, “Earth-Sky,” and Zangban, “Sky-Earth.” The Quiché Maya (of what is now Mexico and Guatemala) called the Universe cahuleu, literally “Sky-Earth.”
That’s where we live. That’s where we come from. The sky and the Earth are one.
Chapter 2
SNOWFLAKES FALLEN ON THE HEARTH
There is not yet one person, one animal, bird, fish, crab, tree, rock, hollow, canyon, meadow, forest. Only the sky alone is there …
Popol Vuh: The Mayan Book of the Dawn of Life1
Before the High and Far-Off Times, O my Best Beloved, came the Time of the Very Beginnings; and that was in the days when the Eldest Magician was getting Things ready. First he got the Earth ready; then he got the Sea ready; and then he told all the Animals that they could come out and play.
RUDYARD KIPLING
“The Crab That Played with the Sea”2
If you could drive an automobile straight down, in an hour or two you would find yourself deep inside the upper mantle of the Earth, far beneath the pediments of the continents, approaching an infernal region where the rock becomes a viscous liquid, mobile and red-hot. And if you could drive for an hour straight up, you would find yourself in the near-vacuum of interplanetary space.3 Beneath you—blue, white, breathtakingly vast, and brimming over with life—would stretch the lovely planet on which our species and so many others have grown up. We inhabit a shallow zone of environmental clemency. Compared to the size of the Earth, it is thinner than the coat of shellac on a large schoolroom globe. But earlier, long ago, even this narrow habitable boundary between hell and heaven was unready to receive life.
——
The Earth accumulates in the dark. Although the primitive Sun is ablaze, there is so much gas and dust between the Earth and the Sun that at first no light gets through. The Earth is embedded in a black cocoon of interplanetary debris. There’s an occasional flash of lightning by which you glimpse a ravaged, pockmarked, not quite spherical world. As it gathers up more and more matter, in units ranging from dust to worldlets, it becomes rounder, less lumpy.
A collision with a hurtling worldlet produces a shattering explosion, and excavates a great crater. Much of the impactor disintegrates into powder and atoms. There are vast numbers of such collisions. Ice is converted to steam. The planet is blanketed in vapor—which holds in the heat from the impacts. The temperature rises until the Earth’s surface becomes entirely molten, a roiling world-ocean of lava, glowing by its own red heat, and surmounted by a stifling atmosphere of steam. These are the final stages of the great gathering in.
In this epoch, when the Earth is new, the most spectacular catastrophe in the history of our planet occurs: a collision with a sizeable world. It does not quite crack the Earth open, but it does blast a good fraction of it out into nearby space. The resulting ring of orbiting debris shortly falls together to become the Moon.
The day is only a few hours long. Gravitational tides raised in the Earth’s oceans and interior by the Moon, and in the Moon’s solid body by the Earth, gradually slow the Earth’s rotation and lengthen the day. From the moment of its formation, the Moon has been drifting away from the Earth. Even now, it hovers over us, a baleful reminder that had the colliding world been much bigger, the Earth would have scattered in fragments through the inner solar system—a short-lived, unlucky world like so many others. Then humans would never have come to be. We would be just one more item on the immense list of unrealized possibilities.
——
Shortly after the Earth had formed, its molten interior was churning, great convection currents circulating, a world in a slow boil. Heavy metal was falling to its center, forming a massive molten core. Motions in the liquid iron began to generate a strong magnetic field.
The time came when the Solar System had pretty well been swept free of gas and dust and rogue worldlets. On Earth, the massive atmosphere—that had kept the heat in—dissipated. Indeed, the collisions themselves helped to drive that atmosphere into space. Convection still carried hot magma up to the surface, but the heat from the molten rock could now be radiated away to space. Slowly the Earth’s surface began to cool. Some of the rock solidified and a thin, at first fragile crust formed, thickened, and hardened. Through blisters and fissures, magma and heat and gases continued to pour out of the interior.
Punctuated by spasmodic flurries of worlds falling out of the sky, the bombardment slowed. Each large impact produced a great dust cloud. There were so many impacts at first that a pall of fine particles enveloped the planet, prevented sunlight from reaching the surface, and in effect turned off the atmospheric greenhouse effect and froze the Earth. There seems to have been a period, after the magma ocean solidified but before the massive bombardment ended, when the once molten Earth became a frozen, battered planet. Who, scanning this desolate world, would have pronounced it fit for life? What wild optimist could have foreseen that peonies and eagles would one day spring from this wasteland?
The original atmosphere had been ejected into space by the relentless rain of worldlets. Now a secondary atmosphere trickled up from the interior and was retained. As the impacts declined, global dust palls became more rare. From the surface of the Earth the Sun would have seemed to be flickering, as in a time-lapse movie. So there was a time when sunlight first broke through the dust pall, when the Sun, Moon, and stars could first be noticed had there been anyone there to see them. There was a first sunrise and a first nightfall.
In sunny intervals, the surface warmed. Outgassed water vapor cooled and condensed; droplets of liquid water formed and trickled down to fill the lowlands and the impact basins. Icebergs continued to fall from the sky, vaporizing on arrival. Torrents of extraterrestrial rain helped form the primeval seas.
Organic molecules are composed of carbon and other atoms. All life on Earth is made from organic molecules. Clearly they had somehow to be synthesized before the origin of life in order for life to arise. Like water, organic molecules came both from down here and from up there. The early atmosphere was energized by ultraviolet light and the wind from the Sun, the flash and crackle of lightning and thunder, auroral electrons, intense early radioactivity, and the shock waves of objects plummeting groundward. When, in the laboratory, such energy sources are introduced into presumptive atmospheres of the primitive Earth, many of the organic building blocks of life are generated, and with astonishing ease.
Life began near the end of the heavy bombardment. This is probably no coincidence The cratered surfaces of the Moon, Mars, and Mercury offer eloquent testimony to how massive and world-altering that battering was. Since the worldlets that have survived to our time—the comets and the asteroids—have sizeable proportions of organic matter, it readily follows that similar worldlets, also rich in organic matter but in much vaster numbers, fell on the Earth 4 billion years ago and may have contributed to the origin of life.
Some of these bodies, and their fragments, burned up entirely as they plunged into the early atmosphere. Others survived unscathed, their cargoes of organic molecules safely delivered to the Earth. Small organic particles drifted down from interplanetary space like a fine sooty snow. We do not know just how much organic matter was delivered to and how much was generated on the early Earth, the ratio of imports to domestic manufactures. But the primitive Earth seems to have been heavily dosed with the stuff of life4—including amino acids (the building blocks of proteins), and nucleotide bases and sugars (the building blocks of the nucleic acids).
Imagine a period hundreds of millions of years long in which the Earth is awash in the building blocks of life. Impacts are erratically altering the climate; temperatures are falling below the freezing point of water when the impact ejecta obscure the Sun, and then warming as the dust settles. There are pools and lakes undergoing wild fluctuations in conditions—now warm, bright, and bathed in solar ultraviolet light, now frozen and dark. Out of this varied and changeable landscape and this rich organic brew, life arises.
Presiding over the skies of Earth at the time of the origin of life was a huge Moon, its familiar surface features being etched by mighty collisions and oceans of lava. If tonight’s Moon looks about as large as a nickel at arm’s length, that ancient Moon might have seemed as big as a saucer. It must have been heartbreakingly lovely. But it was billions of years to the nearest lovers.
We know that the origin of life happened quickly, at least on the time scale by which suns evolve. The magma ocean lasted until about 4.4 billion years ago. The time of the permanent or near-permanent dust pall lasted a little longer. Giant impacts occurred intermittently for hundreds of millions of years after that. The largest ones melted the surface, boiled away the oceans, and flushed the air off into space. This earliest epoch of Earth history is, appropriately, called Hadean, hell-like. Perhaps life arose a number of times, only to be snuffed out by a collision with some wild, careening worldlet newly arrived from the depths of space. Such “impact frustration” of the origin of life seems to have continued until about 4 billion years ago. But by 3.6 billion years ago, life had exuberantly come to be.
——
The Earth is a vast graveyard, and every now and then we dig up one of our ancestors. The oldest known fossils, you might imagine, are microscopic, discovered only by painstaking scientific analysis. Some are. But some of the most ancient traces left by life on Earth are easily visible to the untrained naked eye—although the beings that made them were microscopic. Often meticulously preserved, they’re called stromatolites; not unusual are examples the size of a basketball or a watermelon. A few are half the length of a football field. Stromatolites are big. Their age is read from the radioactive clocks in the ancient basaltic lava in which they are embedded.
They still grow and flourish today—in warm bays, lagoons, and inlets in Baja California, Western Australia, or the Bahamas. They’re composed of successive layers of sediment generated by mats of bacteria. The individual cells live together. They must know how to get on with the neighbors.
We glimpse the earliest lifeforms on Earth and the first message conveyed is not of Nature red in tooth and claw, but of a Nature of cooperation and harmony. Of course, neither extreme is the whole truth; and, examining modern stromatolites more closely, we find single-celled microbes freely swimming in and around the mats. Some of them are busily devouring their fellows. Perhaps they too were there from the beginning.
Some stromatolite communities are photosynthetic; they know how to convert sunlight, water, and carbon dioxide into food. Even today, we humans are unable to build a machine that can perform this transformation with the efficiency of a photosynthetic microbe, much less a liverwort. Yet 3.6 billion years ago the stromatolitic bacteria could do it.
Exactly what happened between the time of the first seas, rich in organic molecules and future prospects, and the time of the first stromatolites is beyond our present ability to reconstruct. Stromatolite-forming microbes could hardly have been the first living things. Before there were colonial forms, there must, it seems, have been individual, free-living, one-celled organisms. And before that, something even simpler. Perhaps before the first photosynthetic organisms, there were little beings that could eat the organic matter littering the landscape: Eating food seems to be a great deal less demanding than manufacturing it. And those little beings themselves had ancestors … and so on, back to the earliest molecule or molecular system able to make crude copies of itself.
Why did colonial forms develop so early? Maybe it was because of the air. Oxygen, generated today by green plants, must have been in short supply before the Earth was covered by vegetation. But ozone is generated from oxygen. No oxygen, no ozone. If there’s no ozone, the searing ultraviolet light (UV) from the Sun will penetrate to the ground. The intensity of UV at the surface of the Earth in those early days may have reached lethal levels for unprotected microbes, as it has on Mars today. We are concerned—and for good reason—that chlorofluorocarbons and other products of our industrial civilization will reduce the amount of ozone by a few tens of percent. The predicted biological consequences are dire. How much more serious it must have been to have no ozone shield at all.
In a world with deadly UV reaching the surface of the waters, sunblock may have been the key to survival—as it may become again. Modern stromatolite microorganisms secrete a kind of extracellular glue that helps them to stick together and also to adhere to the ocean floor. There would have been an optimum depth, not so shallow as to be fried outright by unfiltered UV, and not so deep that the visible light is too feeble for photosynthesis. There, partly shielded by sea-water, it would have been advantageous for the organisms to put some opaque material between themselves and the UV. Suppose, in reproducing, the daughter cells of one-celled organisms did not separate and go their individual ways, but instead remained attached to one another, generating—after many reproductions—an irregular mass. The outer cells would take the brunt of the ultraviolet damage; the inner ones would be protected. If all the cells were spread out thinly on the surface of the sea, all would die; if they were clustered together, most of the interior cells would be sheltered from the deadly radiation. This may have been a potent early impetus for a communal way of life. Some died that others might live.
There are no earlier fossils known, in part because there’s very little of the Earth’s surface surviving from much before 3.6 billion years ago. Almost all the crust from that epoch has been carried deep into our planet’s interior and destroyed. In a rare 3.8-billion-year-old sediment from Greenland, there is some evidence from the kinds of carbon atoms present that life may have been widespread even then. If so, life happened sometime between about 3.8 and maybe 4.0 billion years ago. It could not have arisen much earlier. So—because of the inhospitability of the Hadean Earth, and the need for adequate time to evolve the stromatolite-building microbes—the origin of life must be confined to a comparatively narrow window in the expanse of geological time. Life seems to have arisen very quickly.
Tentatively, tortuously, the orphan is trying to figure out, to the nearest hundred million years, when the family tree took root. “How” is much harder than “when.” Deadly environmental perils, a kind of huddling together for mutual protection, and the deaths—of course, neither willing nor unwilling—of vast numbers of little beings were characteristic of life almost from the beginning. Some microbes were saving their brethren. Others were eating the neighbors.
——
When life was first emerging, the Earth seems to have been mainly an ocean planet, the monotony broken, here and there, by the ramparts of large impact craters. The very beginnings of the continents date back about 4 billion years. Being made of lighter rock, then as now, they sat high on the moving, continent-sized plates. Then as now, the plates apparently were being extruded out of the Earth, carried across its surface as on a great conveyor belt, until plummeting back into the semifluid interior. Meanwhile, new plates were emerging. Vast quantities of mobile rock were slowly exchanged between the surface and the depths. A great heat engine had been established.
By about 3 billion years ago the continents were becoming larger. They were transported halfway around the Earth by the crustal plate machinery, opening one ocean and closing another. Occasionally, continents would crash into each other in exquisite slow motion, the crust would buckle and crinkle, and mountain ranges would be thrust up. Water vapor and other gases spewed out, mainly along mid-ocean ridges and volcanoes at the edges of plates.
Today we can readily detect the growth of continents, their relative motion over the Earth’s surface (sometimes called continental drift), and the subsequent transport of the ocean floor down into the interior, in a style of motion called plate tectonics. The continents tend to stay afloat even when their underlying plates plunge down to destruction. Still, time takes its toll even on continents. Some old continental crust is always being carried to the depths and only bits and pieces of truly ancient continents have survived to our time—in Australia, Canada, Greenland, Swaziland, Zimbabwe.
Greenhouse gases and stratospheric fine particles, both generated by volcanoes, can, respectively, warm or cool the Earth. The changing configuration of the continents determines rainfall and monsoon patterns, and the circulation of warming and cooling ocean currents. When the continents are all aggregated together, the variety of marine environments is limited; when they are scattered over the globe, there are many more kinds of environments, especially those near shore, where a surprising number of the fundamental biological innovations seem to have been made. Thus the history of life, and many of the steps that led to us humans, were governed by great sheets and columns of circulating magma—driven by the heat from long-gone worlds that fell together to make our planet, from the sinking of liquid iron to form the Earth’s core, and from the decay of radioactive atoms originally forged in the death throes of distant stars. Had these events gone a little otherwise, a different amount of heat would have been generated, a different pace or style of plate tectonics elicited, and, from the vast array of possible futures, a different course followed in the evolution of life. Not humans, but some very different species might now be the dominant form of life on Earth.
We know next to nothing about the configuration of the continents over the first 4 billion years. They may many times have been scattered over the oceans and reaggregated into a single mass. For at least 85 percent of Earth history, a map of our planet would have seemed wholly unfamiliar—as if of another world. The earliest well-substantiated reconstruction we can manage dates to as recent a time as 600 million years ago. The Northern Hemisphere then was mostly ocean; in the South, a single massive continent, plus fragments of future continents, drifted across the face of the Earth at about an inch a year—much slower than a snail’s pace. Trees grow vertically faster than continents move horizontally, but if you have millions of years to play with, this is quite sufficient for continents to collide and wholly alter what’s on the maps.
For hundreds of millions of years, what are now the southern continents—Antarctica, Australia, Africa, and South America—plus India, were joined in a common assemblage that geologists call Gondwana.* What was later to be North America, Europe, and Asia were adrift, sailing in pieces through the world ocean. Eventually, all this floating continental debris gathered itself together into one massive supercontinent. Whether we describe it as a landlocked planet with an immense saltwater lake, or an ocean planet with an immense island is only a matter of definition. It might have seemed a friendly world: At least, you could walk anywhere; there were no distant lands across the sea. Geologists call this supercontinent Pangaea—“all Earth.” It included, but of course was considerably larger than, Gondwana.
Pangaea was formed about 270 million years ago, during the Permian Period, a trying time for Earth. Worldwide, conditions had been warming. In some places the humidity was very high and great swamps formed, later to be supplanted by vast deserts. About 255 million years ago Pangaea began to shatter—because, it is thought, of the sudden rise of a superplume of molten lava through the Earth’s mantle from its deep seething core. Texas, Florida, and England were then at the equator North and South China, in separate pieces, Indochina and Malaya together, and fragments of what would later be Siberia were all large islands. Ice ages flickered on and off every 2.5 million years, and the level of the seas correspondingly fell and rose.
Towards the end of the Permian Period, the map of the Earth seems to have been violently reworked. Whole oblasts of Siberia were inundated with lava. Pangaea rotated and drifted north, moving mainland Siberia towards its present position, near the North Pole. “Megamonsoons,” torrential seasonal rains on a much larger scale than humans have ever witnessed, drenched and flooded the land. South China slowly crumpled into Asia. Many volcanoes blew their tops together, belching sulfuric acid into the stratosphere and perhaps playing an important role in cooling the Earth.5 The biological consequences were profound—a worldwide orgy of dying, on land and at sea, the likes of which has never been seen before or since.
The breakup of Pangaea continued. By 100 million years ago South America and Africa, which even today fit together like two pieces of a jigsaw puzzle, were just barely separated by a narrow strait of ocean—receding from one another at about an inch a year. North and South America were then separate continents, with no Isthmus of Panama connecting them. India was a large island headed north away from Madagascar. Greenland and England were connected to Europe. Indonesia, Malaysia, and Japan were part of the mainland of Asia. You might have strolled from Alaska to Siberia. There were great inland seas where none exists today. This time, at a glance from orbit you would have recognized it as the Earth—but with the configuration of land and water strangely altered, as if by a careless, slapdash cartographer. This was the world of the dinosaurs.
Later, the continents drifted further apart, pulled by their underlying plates. Africa and South America continued to recede from one another, opening up the Atlantic. Australia split off from Antarctica. India collided with Asia, raising the Himalayas high. This is the world of the primates.
——
Each of us is a tiny being, permitted to ride on the outermost skin of one of the smaller planets for a few dozen trips around the local star. The great internal engine of plate tectonics is indifferent to life, as are the small changes in the Earth’s orbit and tilt, the variation in the brightness of the Sun, and the impact with the Earth of small worlds on rogue orbits. These processes have no notion of what has been going on over billions of years on our planet’s surface. They do not care.
The longest-lived organisms on Earth endure for about a millionth of the age of our planet. A bacterium lives for one hundred-trillionth of that time. So of course the individual organisms see nothing of the overall pattern—continents, climate, evolution. They barely set foot on the world stage and are promptly snuffed out—yesterday a drop of semen, as the Roman Emperor Marcus Aurelius wrote, tomorrow a handful of ashes. If the Earth were as old as a person, a typical organism would be born, live, and die in a sliver of a second. We are fleeting, transitional creatures, snowflakes fallen on the hearth fire. That we understand even a little of our origins is one of the great triumphs of human insight and courage.
Who we are and why we are here can be glimpsed only by piecing together something of the full picture—which must encompass aeons of time, millions of species, and a multitude of worlds. In this perspective it is not surprising that we are often a mystery to ourselves, that, despite our manifest pretensions, we are so far from being masters even in our own small house.
ON IMPERMANENCE
The present life of man, O king, seems to me, in comparison of that time which is unknown to us, like to the swift flight of a sparrow through the room wherein you sit at supper in winter, with your commanders and ministers, and a good fire in the midst, whilst the storms of rain and snow prevail abroad; the sparrow, I say, flying in at one door, and immediately out at another, whilst he is within, is safe from the wintry storm; but after a short space of fair weather; he immediately vanishes out of your sight, into the dark winter from which he had emerged. So this life of man appears for a short space, but of what went before, or what is to follow, we are utterly ignorant.
THE VENERABLE BEDE Ecclesiastical History8
* You can occasionally see, on the automobile bumper stickers of geology graduate students, the nostalgic plea, “Reunite Gondwanaland” Except in a metaphorical political sense (and it’s not too likely there either) it is the most hopeless of lost causes—on any but a geological time scale But the breakup and separation of continents can go only so far. On a round Earth, what you run away from on one side you will eventually edge into on the other A few hundred million years from now our remote descendants, if any, may witness the reaggregation of a supercontinent Gondwanaland will at last have been reunited* Although not in consequence of some policy of conscious altruism Any individual that goes along with the stromatolitic arrangement is much more likely to find itself safely on the inside rather than perilously on the outside A communal policy benefits most constituent cells—not entirely risk-free, since those on the outside will be fried, but as if a cost-benefit analysis had been performed for the average cell
Chapter 3
“WHAT MAKEST THOU?”
Shall the clay say to him that fashioneth it, What makest thou?
Isaiah 45:9
The world and everything in it was made for us, as we were made for God:
For the last few thousand years, and especially since the end of the Middle Ages, this proud, self-confident assertion was increasingly common belief, held by Emperor and slave, Pope and parish priest. The Earth was a lavishly decorated stage set, designed by an ingenious if inscrutable Director, who had managed to round up, from only He knew where, a multitudinous supporting cast of toucans and mealy bugs, eels, voles, elms, yaks, and much, much more. He placed them all before us, in their opening night costumes. They were ours to do with as we pleased: drag our burdens, pull our plows, guard our homes, produce milk for our babies, offer up their flesh for our dinner tables, and provide useful instruction—bumblebees, for example, on the virtues not just of hard work, but of hereditary monarchy. Why He thought we needed hundreds of distinct species of ticks and roaches, when one or two would have been more than sufficient, why there are more species of beetles than any other kind of being on Earth, no one could say. No matter; the composite effect of life’s extravagant diversity could only be understood by postulating a Maker, not all of whose reasons we could grasp, who had created the stage, the scenery, and the subsidiary players for our benefit. For thousands of years, virtually everyone, theologian and scientist alike, found this, both emotionally and intellectually, a satisfying account.
The man who wrecked this consensus did so with the utmost reluctance. He was no ideologue bent on kicking in the door of the Establishment, no firebrand. If not for a bit of happenstance he would probably have passed his days as a well-liked Church of England parson in a nineteenth-century rural, picture-postcard village. Instead he ignited a firestorm1 that destroyed more of the old order than any violent political upheaval ever had. Through the astonishingly powerful method of science, this gentleman who was known to find lively conversation too taxing, somehow became the revolutionary’s revolutionary. For more than a century, the mere mention of his name has been sufficient to unsettle the pious and rouse the bookburners from their fitful slumbers.
——
Charles Darwin was born at Shrewsbury, England, on February 12, 1809, the fifth child of Robert Waring Darwin and Susannah Wedgwood. The Darwin and Wedgwood families were allied through the close friendship of their patriarchs, Erasmus Darwin, the noted author, physician, and inventor, and Josiah Wedgwood, who had risen from poverty to found the Wedgwood pottery dynasty. These two men shared radically progressive views, even going so far as to side with the rebellious colonies in the American Revolution. “He who allows oppression,” Erasmus wrote, “shares the crime.”2
Their club was called The Lunar Society, because it met only during the full moon when the late-night ride home would be well-lit and therefore less dangerous. Among its members were William Small, who had taught Thomas Jefferson science (at the College of William and Mary in Virginia and whom Jefferson singled out as having “probably fixed the destinies” of his life); James Watt, whose steam engines powered the British Empire; the chemist Joseph Priestley, the discoverer of oxygen; and an expert on electricity named Benjamin Franklin.
The poet Samuel Taylor Coleridge thought Erasmus Darwin “the most original-minded man” he had ever known. Erasmus was also making quite a name for himself as a doctor. George III invited him to become his personal physician. (Erasmus declined the honor out of an unwillingness, he said, to leave his happy home in the countryside, but perhaps the champion of American revolutionaries had political reasons as well.) His real fame, though, stemmed from a string of hit encyclopaedic rhyming poems.
Erasmus Darwin’s two-volume work, The Botanic Garden, comprising The Loves of the Plants, written in 1789, and its eagerly awaited sequel, The Economy of Vegetation, were runaway best-sellers. They were so successful that he decided to tackle the animal kingdom next. The result was a 2,500-page tome, this one in prose, entitled Zoonomia: or, the Laws of Organic Life. In it he asked this prescient question:When we revolve in our minds, first the great changes which we see naturally produced in animals after their nativity as in the production of the butterfly from the crawling caterpillar or of the frog from the subnatant tadpole; secondly when we think over the great changes introduced into various animals by artificial cultivation as in horses or in dogs. .; thirdly when we revolve in our minds the great similarity of structure which obtains in all the warm-blooded animals as well as quadrupeds, birds, amphibious animals as in mankind, would it be too bold to imagine that all warm-blooded animals have arisen from one living filament (archetype, primitive form)?4
Erasmus Darwin believed that “There are three great objects of desire, which have changed the forms of many animals by their exertions to gratify them: hunger, security and lust.” Especially lust. The lilting refrain of his last effort, The Temple of Nature: or, The Origin of Society,5 was “And hail THE DEITIES OF SEXUAL LOVE.” The capitalization is his. Elsewhere, he observed that the stag had developed horns to fight other males for “the exclusive possession of the female.” There’s no question that he was on to something. But his was a kind of disordered originality, a brilliance that could not be bothered by methodical research. Science exacts a substantial entry fee in effort and tedium in exchange for its insights. Erasmus was unwilling to ante up.
His grandson Charles, who would pay those dues, read Zoonomia twice; once when he was eighteen and again a decade later, after he’d been around the world. He took pride in his grandfather’s precocious anticipation of some of the ideas that would make Jean-Baptiste de Lamarck famous twenty years later. However, Charles “was much disappointed” by Erasmus’ failure to investigate, carefully and rigorously, whether there was any truth to his inspired speculations
Lamarck had been a soldier, a self-taught botanist, and the zoologist who had gone on to develop the precursor of the modern natural history museum. When everyone else was thinking in terms of thousands of years, he was contemplating millions. He believed that the idea of the living world walled up into separate compartments called species was an illusion; species are slowly transmogrifying, one into another, he taught, and this would be immediately apparent to us if our lives were not so brief and fleeting.
Lamarck is best known for arguing that an organism could inherit the acquired characteristics of its ancestors. In his most famous example, the giraffe strains to nibble at the leaves on the higher branches of the tree, and somehow the slightly elongated neck that attends the stretching is passed on to the next generation. Lamarck could not have been knowledgeable of the family history of many generations of giraffes, but he did have relevant data that he chose to ignore: For thousands of years, Jews and Moslems have been ritually circumcising their sons, with no break in continuity, and yet not one case is known of a Jewish or Islamic boy born without a foreskin. Queen bees and drones do no work, and have not for geological ages; yet worker bees whose parents are queens and drones (and never other workers) do not seem to be growing more indolent, generation after generation; instead, they are proverbially industrious.6 Domestic and farm animals have their tails docked, their ears clipped, or their flanks branded for generations, but the newborn show no signs of these mutilations. Chinese women had their feet cruelly bound and deformed for centuries, but infant girls obstinately persisted in being born with normal appendages.7 Despite such counterexamples, Charles would take seriously, for his entire life, the notion of Lamarck and his grandfather Erasmus that acquired characteristics could be inherited.
The mechanism by which discrete hereditary units, the genes, are reshuffled and passed on to the next generation, the way in which those genes are randomly altered, their molecular nature, and their wonderful ability to encode long chemical messages and replicate those messages precisely—all this was wholly unknown to Darwin. To attempt an understanding of the evolution of life when heredity was still an almost complete mystery would require either an exceptionally foolish or an exceptionally able scientist.
——
Josiah Wedgwood and Erasmus Darwin had long entertained the hope that someday their children would formalize through marriage the bonds of affection that already united their two families. Of the two, only Erasmus lived to see it happen. His son, Robert, a generous but moody physician, a great big, fat man, a silhouette out of Dickens, who alternately comforted and terrified the patients of his far-flung practice, married Susannah Wedgwood. She was widely admired for her “gentle, sympathising nature” and the active role she took in her husband’s scientific interests. Susannah suffered an agonizing death from a gastrointestinal affliction out of sight but within earshot of her eight-year-old son, Charles. Writing near the end of his own life, he could recall nothing about his mother “except her death-bed, her black velvet gown, and her curiously constructed work-table.”
In this autobiographical memoir, conceived as a gift for his children and grandchildren, and written “as if I were a dead man in another world looking back at my own life,” Charles Darwin admitted “that in many ways I was a naughty boy … I was much given to inventing deliberate falsehoods, and this was always done for the sake of causing excitement.” He boasted to another boy that he “could produce variously coloured polyanthuses and primroses by watering them with certain coloured fluids, which was of course a monstrous fable.” Even at that tender age he had begun to speculate on the variability of plants. His life-long absorption in the natural world was under way. He became a passionate collector of the bits and pieces of Nature that form the gritty detritus in the pockets of children everywhere. He was particularly mad for beetles, but his sister convinced him that it would be immoral to take a beetle’s life merely for collecting. Dutifully, he confined himself to gathering up only the recently deceased. He watched the birds and recorded his observations of their behavior. “In my simplicity,” he later wrote, “I remember wondering why every gentleman did not become an ornithologist.”
At the age of nine he was sent to study at Dr. Butler’s day school. “Nothing could have been worse for the development of my mind,” Darwin later wrote. Butler believed that school was no place for curiosity or excitement about learning. For that, Charles looked to a well-thumbed copy of Wonders of the World, and to the members of his family who patiently answered his many questions. As an old man he could still recall the delight he felt when an uncle had explained to him how the barometer works. His older brother, Erasmus—named after their grandfather—transformed the garden toolhouse into a chemistry lab and allowed Charles to help him with his experiments. This earned Charles the nickname “Gas” at school and an angry public rebuke from Dr Butler.
Charles was doing so poorly at school that when it was time for Erasmus to go off to Edinburgh University, his father decided to send Charles with him. The boys were supposed to study medicine. Here, too, Charles found the lectures oppressively dull. He couldn’t bear to dissect anything, and the experience of seeing a botched operation on a child, “long before the blessed days of chloroform,” was to haunt him for the rest of his life. But it was in Edinburgh that he first found friends who shared his passion for science.
After two sessions at Edinburgh, Robert Darwin became resigned to the fact that Charles was not cut out for a medical career. Perhaps he would make a good clergyman? Dutiful Charles had no objections, but just the same, he thought he should check up on Church of England dogma before agreeing to commit his life to instilling it in others. “Accordingly I read with care Pearson on the Creed, and a few other books on divinity; and as I did not then in the least doubt the strict and literal truth of every word in the Bible, I soon persuaded myself that our Creed must be fully accepted.”
Charles spent the next three years at Cambridge University, where he managed to get better grades. But still he felt a restless dissatisfaction with the curriculum. His happiest moments there were spent in pursuit of his adored beetles, now dead or alive.I will give a proof of my zeal: one day, on tearing off some old bark, I saw two rare beetles, and seized one in each hand; then I saw a third and new kind, which I could not bear to lose, so that I popped the one which I held in my right hand into my mouth. Alas! it ejected some intensely acrid fluid, which burnt my tongue so that I was forced to spit the beetle out, which was lost, as was the third one.
It was as a beetle hunter that the first published reference to Charles Darwin was made. “No poet ever felt more delighted at seeing his first poem published than I did at seeing, in Stephen’s Illustrations of British Insects, the magic words, ‘captured by C. Darwin, Esq.’ ”
At Cambridge he had been persuaded to take a course in geology taught by Adam Sedgwick. Darwin told Professor Sedgwick of the curious but credible claim made to him by a laborer that a “large, worn tropical Volute shell” (the spiral-shaped shell of a warm-water mollusc) had been found embedded in an old Shrewsbury gravel pit. Sedgwick was incurious and dismissive; it must have been dumped there by someone. Darwin remembered in his Autobiography,But then, [Sedgwick added,] if [the shell was] really embedded there it would be the greatest misfortune for geology, as it would overthrow all that we know about the superficial deposits of the Midland Counties. These gravel-beds belong in fact to the glacial period, and in after years I found in them broken arctic shells. But I was then utterly astonished at Sedgwick not being delighted at so wonderful a fact as a tropical shell being found near the surface in the middle of England. Nothing before had ever made me thoroughly realise, though I had read various scientific books, that science consists in grouping facts so that general laws or conclusions may be drawn from them.
At about that time, Darwin’s cousin brought him around to one of the Rev. John Steven Henslow’s botany lectures. This was “a circumstance which influenced my career more than any other.” A handsome man in his early thirties, Henslow had the great teacher’s genius for making his subject come alive, so much so that the same students returned year after year to attend courses they had already completed. Moreover, he exhibited an exceptional sensitivity to the feelings of his students. The novice’s “foolish” question was answered with respect. All were welcome to the open house he held every week, and there were regular invitations to dinner with his family. Darwin wrote, “during the latter half of my time at Cambridge I took long walks with him on most days; so that I was called by some of the dons ‘the man who walks with Henslow.’ ” Darwin judged his knowledge “great in botany, entomology, chemistry, mineralogy, and geology.” He added that Henslow was “deeply religious, and so orthodox that he told me one day he should be grieved if a single word of the Thirty-nine Articles [of the Anglican faith] were altered.”
Ironically, it was Henslow who left the message “informing me that Captain FitzRoy was willing to give up part of his own cabin to any young man who would volunteer to go with him without pay as naturalist to the Voyage of the Beagle.” Henslow wrote of “a trip to Tierra del Fuego, and home by the East Indies … Two years … I assure you I think you are the very man they are in search of.”
The scene is not hard to imagine: The twenty-two-year-old races home from college breathless with excitement. He squirms in his chair while Father, an intimidating man in the best of circumstances, harangues him with a litany of past indulgences and harebrained schemes. First, doctor, then, clergyman, now, this? Afterwards, what congregation will want you? They must have first offered it to others and been turned down … Doubtless something is seriously wrong with the vessel … Or the expedition …
And then, after much discussion: “If you can find any man of common sense, who advises you to go, I will give my consent.”10 The chastened son regards the situation as hopeless and sends Henslow polite regrets.
The next day he rides over to the Wedgwoods’ for a visit. Uncle Josiah—named after Charles’ grandfather’s boon companion—sees the voyage as a once-in-a-lifetime opportunity. He drops what he’s doing to write Charles’ father a point-by-point refutation of his objections. Later that same day, Josiah worries that a personal appearance might accomplish what a note might not. He grabs Charles and gallops over to the Darwin household to try to convince the young man’s father to let him go. Robert keeps his word and agrees. Touched by his father’s generosity and feeling a little guilty over past extravagances, Charles seeks to reconcile him, saying, “I should be deuced clever to spend more than my allowance whilst on board the Beagle.”
“But they tell me you are very clever,” his father answers with a smile.
Robert Darwin had given his blessing, but some obstacles still remained. Captain Robert FitzRoy was having second thoughts about sharing such close quarters for such an extended period of time. A relation of his had known the young Darwin at Cambridge. He said he wasn’t a bad sort, but did FitzRoy, the high Tory, know that he’d be rooming for two years with a Whig? And then there was the pesky problem of Darwin’s nose. FitzRoy was, as were many of his contemporaries, a believer in phrenology, which held that the shape of the skull was indicative of intelligence and character, or their absence. Some adherents expanded this doctrine to include noses. To FitzRoy, Darwin’s nose proclaimed at a glance grave deficiencies in energy and determination. After the two men had spent a little time together, though, FitzRoy, despite his reservations, decided to take a chance on the young naturalist. Darwin wrote, “I think he was afterwards well satisfied that my nose had spoken falsely.”
The Beagle’s earlier survey mission to South America had been such an unpleasant experience, the weather so consistently rotten, that her Captain had committed suicide before it was over. The British admiralty office in Rio de Janeiro turned to the twenty-three-year-old Robert FitzRoy to assume command. By all accounts he did brilliantly. He was at the helm when the Beagle resumed her survey of Tierra del Fuego and the islands nearby. After the theft of one of the Beagle’s whale boats, FitzRoy kidnapped five of the local people, who were called Fuegians by the British. When he gave up hope of recovering the boat and humanely released his hostages, one of them, a little girl they called Fuegia Basket, didn’t want to leave—or so the story goes. FitzRoy had been wondering about bringing some Fuegians back to England so they might learn its language, mores, and religion. Upon returning home, FitzRoy imagined, they would provide a liaison with other Fuegians and become loyal protectors of British interests at the strategic southern tip of South America. The Lords Commissioners of the Admiralty granted FitzRoy permission to bring the Fuegians to England. Although they were vaccinated, one died of smallpox. Fuegia Basket, a teenaged boy they called Jemmy Button, and a young man they called York Minster survived to study English and Christianity with a clergyman in Wandsworth, and to be presented by FitzRoy to the King and Queen.
Now it was time for the Fuegians—whose real names no one in England had bothered to learn—to go back; and for the Beagle to resume her survey of South America and “to determine more accurately … the longitude of a large number of oceanic islands as well as of the continents.”11 This assignment was expanded to include “observations of longitude right round the world.” She would sail down the east coast of South America, up the west coast, cross the Pacific, and circumnavigate the planet before returning home to England. Once the Beagle had been re-commissioned under Captain FitzRoy’s command, he took measures to insure that this new expedition would be very different from the previous one. Largely at his own expense, he had the 90-foot square-rigger completely re-fit. He resurfaced her hull, raised her deck, and festooned her bowsprit and her three tall masts with state-of-the-art lightning conductors. He tried to learn everything he could about weather and became one of the founders of modern meteorology in the process. On December 27, 1831, the Beagle was finally ready to sail.
On the eve of her departure, Darwin had suffered an anxiety attack and heart palpitations. There would be episodes of these symptoms, gastrointestinal distress, and profound bouts of exhaustion and depression throughout his life. Much speculation has been offered on the cause of these spells. They’ve been attributed to a psychosomatic reaction to the traumatic loss of his mother at so tender an age; to anxieties about the reactions his life’s work might elicit from God and the public; to an unconscious tendency to hyperventilate; and, strangely, although the symptoms pre-date his marriage by many years, to the pleasure he took in his beloved wife’s genius for nursing the sick. The sequence of events also makes implausible the contention that his illness was due to a South American parasite acquired during the Beagle’s voyage. We simply do not know. His symptoms caused this explorer to be mainly housebound for the last third of his life.
Darwin’s personal library on the journey included two books, each a bon voyage gift. One was an English translation of Humboldt’s Travels that Henslow had given him. Before Darwin left Cambridge he had read Humboldt’s Personal Narrative and Herschel’s Introduction to the Study of Natural Philosophy, which together evoked in Darwin “a burning zeal to add even the most humble contribution to the noble structure of Natural Science.”12 The other gift was from the Captain. It was Volume I of Charles Lyell’s Principles of Geology, and FitzRoy would live to regret bitterly his choice of going-away present.
The scientific revelations of the European Enlightenment had posed disturbing challenges to the biblical account of the Earth’s origin and history. There were those who tried to reconcile the new data and new insights with their faith. They held that Noah’s flood was the primary agent responsible for the present configuration of the Earth’s crust. A big enough flood, they thought, could transform the Earth’s geology in just forty days and forty nights, consistent with an Earth only a few thousand years old. With a little spin control on a literal reading of the Book of Genesis, they felt they had managed to pull it off.
Lyell had been a lawyer for as long as he could stand it. When he was thirty years old, he abandoned the law for geology, his true passion. He wrote Principles of Geology to advance the “Uniformitarian” view that the Earth has been shaped by the same gradual processes that we observe today, but operating not merely over a few weeks, or a few thousand years, but ages. There were distinguished geologists who held that floods and other catastrophes might explain the Earth’s landforms, but that the Noachic flood wasn’t enough. It would take many floods, many catastrophes. These scientific Catastrophists were comfortable with Lyell’s long time scales But for the biblical literalists Lyell posed an awkward problem. If Lyell was right, the rocks were saying that the Bible’s six days of Creation, and the age of the Earth deduced by adding up the “begats,” were somehow in error It was through this apparent hole in Genesis that the Beagle would sail into history.
Hired mainly as FitzRoy’s companion and sounding board, Darwin was obliged to bear with equanimity the Captain’s politically conservative, racist, and fundamentalist harangues. For most of the voyage, the two men managed to maintain a truce with regard to their philosophical and political differences. However, Darwin was simply unable to let FitzRoy’s opinion on one particular issue go unchallenged:[A]t Bahia, in Brazil, he defended and praised slavery, which I abominated, and told me that he had just visited a great slave-owner, who had called up many of his slaves and asked them whether they wished to be free, and all answered “No.” I then asked him, perhaps with a sneer, whether he thought that the answers of slaves in the presence of their master was worth anything? This made him excessively angry, and he said that as I doubted his word we could not live any longer together.13
Darwin fully expected to be kicked off the ship. But when the gunroom officers heard of the row, they vied with each other for the privilege of sharing their quarters with him. FitzRoy calmed down and actually apologized to Darwin, rescinding the eviction. Possibly, Darwin’s evolutionary views emerged, in part, out of his exasperation with FitzRoy’s inflexible conventionalism, and the necessity of the young man to suppress for five years the counterarguments that were welling up inside him14
Perhaps it was the legacy of his grandfathers that enabled Darwin to detect the inconsistencies and injustices that other members of his social class would not see. At the very beginning of his book, The Voyage of the Beagle, he tells of a place not far from Rio de Janeiro:This spot is notorious from having been, for a long time, the residence of some runaway slaves, who, by cultivating a little ground near the top, contrived to eke out a subsistence. At length they were discovered, and a party of soldiers being sent, the whole were seized with the exception of one old woman, who, sooner than again be led into slavery, dashed herself to pieces from the summit of the mountain. In a Roman matron this would have been called the noble love of freedom: in a poor negress it is mere brutal obstinacy.15
Darwin had been lured to South America by the prospect of discovering new birds and new beetles, but he couldn’t help noticing the carnage the Europeans were inflicting. Colonial arrogance, the institution of slavery, the extirpation of countless species for the enrichment and entertainment of the invaders, the first depredations of the tropical rain forest—in short, many of the crimes and stupidities that haunt us today—troubled Darwin at a time when Europe was confident that colonialism was an unalloyed benefit for the uncivilized, that the forests were inexhaustible, and that there would always be enough egret feathers for every millinery shop until the Day of Judgment. In part because of these sensitivities, in part because Darwin always wrote as clearly and directly as he could—striving to communicate to the greatest number of people—The Voyage of the Beagle is still a stirring and accessible adventure story.
However, this book has watershed status because it was during the course of the expedition it recounts that Darwin began to amass the great body of evidence—not intuition, but data—that makes the case for evolution by natural selection. “At last gleams of light have come,” he was later to write, “and I am almost convinced that species are not (it is like confessing a murder) immutable.”
The Galapagos is an archipelago of thirteen good-sized islands and many smaller ones lying off the coast of Ecuador. If all the species on Earth were immutable, then why did the beaks of the otherwise very similar finches on islands separated by no more than fifty or sixty miles of ocean vary so dramatically? Why narrow, tiny, pointy beaks on the finches of one island and larger, parrot-like curved beaks on the finches of the next? “Seeing this gradation and diversity of structure in one, small intimately related group of birds,” he later wrote in The Voyage, “one might really fancy that, from an original paucity of birds in this archipelago, one species had been taken and modified for different ends.” (These volcanic islands, we now know, are less than 5 million years old.) And it wasn’t just the finches that raised such problems, but the giant tortoises and the mockingbirds, too.
Back in England, Henslow and Sedgwick had been reading Darwin’s letters aloud at meetings of scientific societies. When Darwin returned home in October 1836, he found he had acquired something of a reputation as an explorer and naturalist. His father was now well pleased with him, and all talk of a parsonage ceased. The same month he met the geologist, Lyell, for the first time. Though not without its rough spots, it was to be a lifelong friendship.
Darwin made important contributions to geology. His interpretation of coral reefs—that they mark the locations of slowly subsiding sea-mounts that had once been islands—was substantiated on the Beagle and corresponds to the modern understanding. In 1838 he published a paper arguing that earthquakes, volcanoes, and the thrusting up of islands are all caused by slow, intermittent, but irresistible global motions in the semi-liquid interior of the Earth. This “almost prophetic”16 thesis, as far as it goes, is part and parcel of modern geophysics. In his 1838 Presidential Address to the Geological Society, William Whewell mentioned Darwin’s name (in the context of this work) more than twice as often as any other geologist, living or dead. In geology, following Lyell, as in biology, Darwin championed the idea that profound changes are worked little by little over vast intervals of time.
In 1839, he married his cousin, Emma Wedgwood. Through ten children and more than four decades they shared a deep, loving, and almost entirely harmonious relationship. During their early married life he was writing down, but certainly not for publication, his first tentative sketch for a theory of evolution. Their rare differences were over religion. “Before I was engaged to be married,” he wrote in his autobiography, “my father advised me to conceal carefully my doubts, for he said that he had known extreme misery thus caused with married persons.”17 A few weeks after their wedding, she wrote to him:May not the habit in scientific pursuits of believing nothing till it is proved influence your mind too much in other things which cannot be proved in the same way, and which if true are likely to be above our comprehension?
Years later, Darwin wrote at the bottom of Emma’s letter,When I am dead, know that many times,
I have kissed and cried over this.18
He tried his best to avoid the public version of this domestic tension. Our past was then a dark and shameful secret. To expose it would have been perceived by many as an affront to the prevailing religious norms and as an assault against human dignity. But to suppress it would have been to reject the data because the implications were disturbing. Darwin recognized that if he was to convince anyone he would have to support his argument with a compelling body of evidence.
In 1844, a sensational book, fundamentally pseudoscience, called Vestiges of the Natural History of Creation was published. Robert Chambers, the encyclopedist and amateur geologist who was its anonymous author, claimed that he had traced human ancestry all the way back to … frogs. Chambers’ reasoning was half-baked (although no more so than Erasmus Darwin’s) but its audacity attracted a great deal of attention. Nagging doubts about Creation were beginning to bubble to the surface, and Darwin felt that he should write down his own theory in as irrefutable a form as possible. He expanded a short essay, begun two years before, into a two-part work entitled “On the Variation of Organic Beings under Domestication and in the Natural State” and “On the Evidence Favourable and Opposed to the View That Species Are Naturally Formed Races Descended from Common Stock.” However, he was not ready to publish. He wrote a letter to Emma that he asked be considered as a codicil to his will. In the event of his death, he wanted her todevote £400 to its publication and further will yourself … take trouble in promoting it—I wish that my sketch be given to some competent person, with this sum to induce him to take trouble in its improvement and enlargement.19
He felt he was on to something important, but feared—perhaps especially in view of his frequent bouts of illness—that he would not live to complete the work.
In what superficially seems an odd next move, he now put his evolutionary studies aside and for the next eight years devoted his life almost exclusively to barnacles. His great friend, the botanist Joseph Hooker, would later observe to Darwin’s son, Francis, “Your father had Barnacles on the brain from Chili [Chile] onwards!”20 It was this exhaustive project that really earned him his credentials as a naturalist. Another close friend, the anatomist and brilliant polemicist Thomas Henry Huxley, observed that Darwinnever did a wiser thing … Like the rest of us, he had no proper training in biological science, and it has always struck me as a remarkable instance of his scientific insight, that he saw the necessity of giving himself such training, and of his courage, that he did not shirk the labour of obtaining it … It was a piece of critical self-discipline, the effect of which manifested itself in everything [he] wrote afterwards, and saved him from endless errors of detail.21
Darwin had not been the only scientist to get a jolt from Chambers’ Vestiges. Alfred Russel Wallace, a surveyor who had become a naturalist, was also unimpressed with Chambers’ arguments, but also intrigued by the notion that there was a knowable process at work in the evolution of life. In 1847, he traveled to the Amazon in search of factual support for this idea. A fire on the ship taking him back to England consumed every one of his specimens. Wallace persevered, setting off to the Malay Peninsula to gather a new collection. In the September 1855 issue of Annals and Magazine of Natural History, his paper “On the Law Which Has Regulated the Introduction of New Species” appeared.
By this time, Darwin had been wrestling with such problems for two decades. Now, it was entirely possible that his claims of priority to the solution of life’s greatest mystery would be snatched away. If science were in the business of conferring sainthood, the conduct of Darwin and Wallace towards one another would have earned it for them both. Darwin wrote a letter of hearty congratulation to Wallace in which he mentioned how long he’d been working on the same problem.
Darwin’s friends Huxley and Hooker prodded him to quit stalling and write the paper that would make an ironclad case for evolution. He complied and was nearing its completion in 1858, while Wallace, now in Indonesia and sick with malaria, tossed and turned, grappling with the question “Why do some die and some live?”22 Emerging from his stupor, he understood natural selection. He wrote “On the Tendency of Varieties to Depart Indefinitely from the Original Type” and promptly mailed it to Darwin, asking him to use his judgment about what should be done with it. Darwin was distressed to see how very close Wallace’s work was to his own writings of 1839 and 1842. In 1844 he had combined them into an essay, but it remained unpublished. Darwin turned to his friends for guidance on how to deal ethically with this dilemma. Hooker and Lyell came up with a wise solution: Present both the Wallace paper and a version of Darwin’s unpublished 1844 essay at the next meeting of the Linnaean Society and publish them together in the Society’s Proceedings.23 Thereafter, Wallace always spoke of evolution as being Darwin’s theory and Darwin always credited Wallace with its independent discovery. Darwin now applied himself to the task of writing the book that would cause so much trouble.
On November 24, 1859, The Origin of Species was published. The first edition of 1,250 copies was snapped up by the booksellers. Darwin had been careful to make only one reference to humans in the whole book: “Light will be thrown on the origin of man and his history.”24 Anything more from his pen on this delicate matter would have to wait another twelve years, for the publication of The Descent of Man. His restraint fooled no one. Given its formidable armamentarium of data, there could be no reconciling The Origin with a literal rendition of Genesis.
Chapter 4
A GOSPEL OF DIRT
I detest all systems that depreciate human
nature. If it be a delusion that there is
something in the constitution of man that is
venerable and worthy of its author, let me live
and die in that delusion, rather than have my
eyes opened to see my species in a humiliating
and disgusting light. Every good man feels his
indignation rise against those who disparage his
kindred or his country; why should it not rise
against those who disparage his kind?
THOMAS REID
letter of 17751
When I view all beings not as special creations,
but as the lineal descendants of some few
beings which lived long before the first bed of
the Cambrian [geological] system was
deposited, they seem to me to become
ennobled.
CHARLES DARWIN
The Origin of Species, Chapter XV2
Mankind has conducted an experiment of gigantic proportions,” Darwin wrote in The Origin of Species. He was struck by the success of “husbandry,” as it is tellingly called, in generating new varieties of animals and plants useful for humans. Nature provides the varieties and we select who shall reproduce, which traits we want preferentially to propagate into future generations. By transferring pollen from flower to flower with a camel’s hair brush, or by letting the stallion in with the mare, humans take it upon themselves to determine who shall mate with whom. Indigestible crops, weakling horses, scrawny turkeys, sheep with knotty coats, and cows that are grudging with their milk are discouraged from reproducing. Generation after generation, by cumulative selection, humans impress their interests on the heredity of the plants and animals whose breeding they control. But Nature, too, selects those plants and animals which by its lights happen to be more favorably adapted than their fellows; such fortunate beings preferentially reproduce, leave more offspring and, as time goes on, supplant the competition. Artificial selection helps us to understand how natural selection works.
The ability of the environment to nurture and sustain large populations—the so-called carrying capacity—is of course finite. As the number of organisms increases, not all will be able to survive. There will be a stringent competition for scarce resources. Slight differences in ability, imperceptible to a casual observer, may spell life or death to the organism. Natural selection is a great sieve, straining out the vast majority and permitting only a tiny vanguard to pass its heredity on to the next generation. Natural selection is far more ruthless than the most callous and resolute animal breeder in determining the genetic makeup of future generations. And instead of the measly few thousand years since the domestication of animals began in earnest, natural selection has been working for billions.
Consider the diverse specializations that, through artificial selection, we’ve generated in dogs—greyhounds and borzois for speed, to outrun the wolves; collies for herding sheep; beagles, pointers, and setters for hunting; Labrador retrievers for helping fishermen gather their nets; guide dogs for the blind; bloodhounds for tracking criminals; terriers for worrying prey out of burrows; mastiffs for guard duty; and the original Pekinese (of which only a dwarf remnant remains) for war. We did all that, in only a few thousand years, by meddling with the sex lives of dogs. We evolved cauliflower, rutabaga, broccoli, brussels sprouts, and the now common and luxuriant cabbage from the sorry wild cabbage (these vegetables, like the different breeds of dogs, remain interfertile). Now think of a much more rigorous, much more stringent selection operating on all of Nature over an expanse of time a million times longer—and established not by the conscious meddling of dog or plant breeders with some idea of what kind of dog or plant they’re aiming for, but by a blind, purposeless, and changing environment. If artificial selection represents an experiment of gigantic proportions, what must be the dimensions of the experiment that natural selection has performed? Isn’t it plausible that all the elegantly adaptive diversity of life on Earth could thereby be sifted and extracted? Indeed, it is the only known process that adapts organisms to their environments.3
Here are the passages from Darwin’s Origin of Species in which he first develops the point and counterpoint of artificial and natural selection:One of the most remarkable features in our domesticated races is that we see in them adaptation, not indeed to the animal’s or plant’s own good, but to man’s use or fancy. Some variations useful to him have probably arisen suddenly, or by one step … But when we compare the dray-horse and race-horse, the dromedary and camel, the various breeds of sheep fitted either for cultivated land or mountain pasture, with the wool of one breed good for one purpose, and that of another breed for another purpose; when we compare the many breeds of dogs, each good for man in different ways; when we compare the game-cock, so pertinacious in battle, with other breeds so little quarrelsome, with “everlasting layers” [of eggs, which never desire to sit, and with the bantam so small and elegant; when we compare the host of agricultural, culinary, orchard, and flower-garden races of plants, most useful to man at different seasons and for different purposes, or so beautiful in his eyes, we must, I think, look further than to mere variability. We cannot suppose that all the breeds were suddenly produced as perfect and as useful as we now see them; indeed, in many cases, we know that this has not been their history. The key is man’s power of accumulative selection: nature gives successive variations; man adds them up in certain directions useful to him. In this sense he may be said to have made for himself useful breeds.
… [H]ardly any one is so careless as to breed from his worst animals …
If there exist savages so barbarous as never to think of the inherited character of the offspring of their domestic animals, yet any one animal particularly useful to them, for any special purpose, would be carefully preserved during famines and other accidents, to which savages are so liable, and such choice animals would thus generally leave more offspring than the inferior ones; so that in this case there would be a kind of unconscious selection going on …
Man … can never act by selection, excepting on variations which are first given to him in some slight degree by nature …
This preservation [in Nature] of favourable individual differences and variations, and the destruction of those which are injurious, I have called Natural Selection, or the Survival of the Fittest Variations neither useful nor injurious would not be affected by natural selection …
When we see leaf-eating insects green, and bark-feeders mottled-grey; the alpine ptarmigan white in winter, the red-grouse the colour of heather, we must believe that these tints are of service to these birds and insects in preserving them from danger …
If it profit a plant to have its seeds more and more widely disseminated by the wind, I can see no greater difficulty in this being effected through natural selection, than in the cotton-planter increasing and improving by selection the down in the pods on his cotton-trees …
There is no reason why the principles which have acted so efficiently under domestication should not have acted under nature. In the survival of favoured individuals and races, during the constantly-recurrent Struggle for Existence, we see a powerful and ever-acting form of Selection. The struggle for existence inevitably follows from the high geometrical ratio of increase which is common to all organic beings. This high rate of increase is proved by calculation,—by the rapid increase of many animals and plants during a succession of peculiar seasons, and when naturalised in new countries. More individuals are born than can possibly survive. A grain in the balance may determine which individuals shall live and which shall die,—which variety or species shall increase in number, and which shall decrease, or finally become extinct … The slightest advantage in certain individuals, at any age or during any season, over those with which they come into competition, or better adaptation in however slight a degree to the surrounding physical conditions, will, in the long run, turn the balance.4
In his 1858 paper in the Linnaean Society Proceedings, he asks us to imagine a being who could continue selecting, with unfailing attention, for a single desired characteristic over “millions of generations.” Natural selection implies—in effect, although not literally—that such a being exists. “We have almost unlimited time” for evolution, he wrote.
Darwin then went on to propose that, over such immense periods of time, continuing natural selection may generate such a divergence of an organism from its parental stock as to constitute a new species. Giraffes develop long necks because those whose necks are—by some spontaneous genetic variation—a little longer are able to browse on the topmost foliage, flourish when others are ill-fed, and leave more offspring than their shorter-necked fellows. He pictured a vast family tree, symbolic of the varied forms of life, slowly growing, branching, and anastomosing, organisms evolving to produce all the “exquisite adaptations” of the natural world.
There is “grandeur,” he thought, in the fact that “from so simple a beginning, endless forms most beautiful and most wonderful have been, and are being evolved.”Analogy would lead me one step farther, namely, to the belief that all animals and plants are descended from some one prototype. But analogy may be a deceitful guide. Nevertheless all living things have much in common, in their chemical composition, their cellular structure, their laws of growth, and their liability to injurious influences.… [O]n the principle of natural selection with divergence of character, it does not seem incredible that, from such low and intermediate form, both animals and plants may have been developed; and, if we admit this, we must likewise admit that all the organic beings which have ever lived on this earth may be descended from some one primordial form.
And how did such a primordial form arise? In 1871, Darwin wistfully imagined, in a letter to his friend Joseph Hooker, “But if (and oh! what a big if!) we could conceive in some warm little pond, with all sorts of ammonia and phosphoric salts, light, heat, electricity, &c., present, that a proteine compound was chemically formed, ready to undergo still more complex changes …”5
If such a thing were possible, why isn’t it happening today? Darwin immediately foresaw one reason: “At the present day, such matter would be instantly devoured or absorbed, which would not have been the case before living creatures were formed.” In addition, we now know that the absence of the oxygen molecule in the atmosphere of the primitive Earth made the formation and survival of organic molecules then much more likely. (And vastly more organic molecules were falling from the sky than do so today in our tidied-up and regularized Solar System.) That warm little pond—or something like it—laboratory experiments show, could have quickly produced the amino acids. Amino acids, energized a little, readily join up to make something like “a proteine compound.” In related experiments, simple nucleic acids are made. Darwin’s guess, as far as it went, is today pretty well confirmed. The building blocks of life were abundant on the early Earth, although we certainly cannot yet say we fully understand the origin of life. But we humans, starting with Darwin, have only just begun to look into the matter.
——
The publication of The Origin of Species met, as might have been expected, with a passionate response, both pro and con, including a stormy meeting of the British Association for the Advancement of Science shortly after publication. The larger debate can perhaps best be glimpsed by disinterring the literary reviews of the day. These magazines, generally published monthly, covered the widest range of topics—fiction and nonfiction, prose and poetry, politics, philosophy, religion, and science. Reviews of twenty printed pages were not uncommon. Almost all articles were unsigned, although many were written by the leading figures in their fields. Comparable publications in the English language seem sparse today, although The Times of London’s Literary Supplement and The New York Review of Books perhaps come closest.
The Westminster Review of January 1860 recognized that Darwin’s book might be of historic significance:If the principle of Modification by Natural Selection should be admitted to anything like the extent to which Mr. Darwin would carry it … a grand and almost untrodden field of inquiry will be opened … Our classifications will come to be, as far as they can be so made, genealogies; and will then truly give what may be called the plan of creation.6
The Edinburgh Review of April 1860 (in an unsigned critique by the anatomist Richard Owen) took a less charitable view:The considerations involved in the attempt to disclose the origin of the worm are inadequate to the requirements of the higher problem of the origin of man … To him, indeed, who may deem himself devoid of soul and as the brute that perisheth, any speculation, pointing, with the smallest feasibility, to an intelligible notion of the way of coming in of a lower organised species, may be sufficient, and he need concern himself no further about his own relations to a Creator … Mr. Darwin offers us … intellectual husks … endorsed by his firm belief in their nutritive sufficiency.7
The reviewer praises scientists “who trouble the intellectual world little with their beliefs, but enrich it greatly with their proofs,” and contrasts them to Darwin, who is said to have no more than “a discursive and superficial knowledge of nature.”
Professor Owen is much impressed by the work of Cuvier on the mummified ibises, cats, and crocodiles “preserved in the tombs of Egypt,” which prove “that no change in their specific characters has taken place during the thousands of years … which had elapsed … since the individuals of those species were the subjects of the mummifier’s skill.” Cuvier’s data, it is said, were of “far higher value” than the “speculations” of Darwin. But the mummified animals of ancient Egypt walked the Earth only a split second ago on the geological time scale—not nearly long enough ago to show major evolutionary change, which characteristically requires millions of years. Owen’s review ripples with florid scorn: “Prosaic minds,” it says, “are apt to bore one by asking for our proofs, and one feels almost provoked, when seduced to the brink of such a draught of forbidden knowledge as the [evolutionists] offer, to have the Circean cup dashed away” by more knowledgeable experts of a different opinion.
Other commentators raised more substantial objections: No example of a beneficial mutation or hereditary change is known, it was said; Darwin must invoke enormous intervals of time before the epoch of the dinosaurs, and yet no sign of life could be found in the earlier geological record; transitional forms between one species and the other were said to be wholly lacking in the geological record. In fact Darwin stressed the almost total ignorance in his time of the nature of hereditary transmission and mutation, and he himself pointed to the sparseness of the geological record as a problem for the theory (although he also said he would produce the transitional fossils when his opponents showed him all the intermediate forms between wild dogs and greyhounds, say, or bulldogs). Since then, not only have the laws of inheritance by genes and chromosomes (which are made entirely of nucleic acids) been carefully worked out, but their detailed molecular structure is known; we even understand how a mutation can be caused by the substitution of a single atom for another. The geological record has been extended not only to before the time of the dinosaurs, but we now have spotty glimpses of life through the preceding 3.5 billion years. Despite his exhaustive studies of artificial selection, Darwin did not know of a single case history of natural selection in the wild; today we know of hundreds.8 The fossil evidence remains sparse, though: A few more transitional forms are now known—Archeopteryx, for example, a halfway house between reptile and bird—but still not nearly enough to show even the majority of the important evolutionary pathways. But the most powerful evidence for evolution comes, as we will see, from a science whose very existence was unknown in Darwin’s time—molecular biology.
A critique in The North American Review for April 1860 attempts to refute Darwin by a kind of unselfconscious sophism: The very long periods of geological time required for evolution are declared “virtually infinite.” Darwin himself used similarly loose mathematical language. Then the review goes on to assert that “the difference between such a conception and that of the strictly infinite, if any, is not appreciable.” Infinity, however, belongs not to science but to metaphysics, so the reviewer concludes that the theory of evolution is not scientific but metaphysical—“resting altogether upon the idea of ‘the infinite,’ which the human mind can neither put aside nor comprehend.”9 This last point would seem to apply, especially, to the reviewer. In fact, any two numbers, no matter how large or small, are equally distant from infinity, and 4.5 billion years is a respectably finite period of time. Infinity does not enter the evolutionary perspective. The speciousness of this argument (and other critiques) gives us a sense of how anxious people were to reject Darwin’s ideas. (His later suggestion that all living things including humans were still evolving, and that in the far future our descendants would not be human, was dismissed even by sympathetic reviewers as going too far.)
In The London Quarterly Review of July 1860, in an article called “Darwin’s Origin of Species,” Darwin is anonymously taken to task by his adversary Samuel Wilberforce, the Anglican Bishop of Oxford—among many other things, for “wantonness of conjecture” and “extravagant liberty of speculation.” His “mode of dealing with nature” is condemned asutterly dishonourable to all natural science, as reducing it from its present lofty level as one of the noblest trainers of man’s intellect and instructors of his mind, to being a mere idle play of the fancy, without the basis of fact or the discipline of observation.
He is accused of circumventing “the obstinacy of fact” by waving a magic wand and saying, “ ‘Throw in a few hundreds of millions of years more or less, and why should not all these changes be possible …?’ ”
The terrible implication is drawn that Darwin’s unexpressed supposition was that “man” might be only “an improved ape.” (Wilberforce on this point was not far from the mark; this is close to what Darwin thought.) That natural selection might apply to humans is denounced as “absolutely incompatible” with “the Word of God.” Moreover, “man’s derived supremacy over the earth; man’s power of articulate speech; man’s gift of reason; man’s free-will and responsibility; man’s fall and man’s redemption; the Incarnation of the Eternal Son; the indwelling of the Eternal Spirit, all are equally and utterly irreconcilable with the degrading notion of the brute origin of him who was created in the image of God, and redeemed by the Eternal Son.” The idea of evolution tends “inevitably to banish from the mind most of the peculiar attributes of the Almighty.” Darwin’s insights are compared to “the frenzied inspiration of the inhaler of mephitic gas.” His views are contrasted by Bishop Wilberforce with those of “a far greater philosopher,” Professor Owen, whom he quotes, a little tangentially, as advising teenagers:Oh! you who possess it in all the supple vigour of lusty youth, think well what it is that He has committed to your keeping. Waste not its energies; cull them not by sloth; spoil them not by pleasures! The supreme work of creation has been accomplished that you might possess a body—the sole erect—of all animal bodies the most free—and for what? for the service of the soul . . Defile it not.10
The North British Review of May 1860, no less hostile, begins its critique: “If notoriety be any proof of successful authorship, Mr. Darwin has had his reward.” Darwin is compared with writers who “seem ever distrustful of views of nature which, even remotely, tend to set them or their readers in direct relation with a personal God.” As in many of the negative reviews, this one acknowledges Darwin’s reputation as an accomplished naturalist and praises his felicity of style. He is, though, a “charlatan” and guilty of “unbelief in the governing Creator.” The book’s “seeming depth is only darkness.” He is accused of setting a throne “somewhere, above Olympus, and the goddess of the author’s devotion is seated on it.” This goddess is Natural Selection. “The ‘chance’ of heathenism has developed into a higher form … Mr. Darwin’s work,” The North British Review concludes, “is in direct antagonism to all the findings of a natural theology, formed on legitimate inductions in the study of the works of God; and it does open violence to everything which the Creator Himself has told us in the Scriptures of truth.” The publication of The Origin of Species is said to have been a “mistake.” “Its author would have done well to science, and to his own fame, had he, being determined to write it, put it away among his papers, marked, ‘A Contribution to Scientific Speculation in 1720’ ” —that being the reviewer’s estimate of how retrogressive and passé Darwin’s argument was.11
The process of natural selection, extracting order out of chaos as if by magic, was counterintuitive and disturbing to many, and Darwin was repeatedly accused of something not far short of idolatry. He answered the charge in these words:It has been said that I speak of natural selection as an active power or Deity; but who objects to an author speaking of the attraction of gravity as ruling the movements of the planets? Every one knows what is meant and is implied by such metaphorical expressions; and they are almost necessary for brevity. So again it is difficult to avoid personifying the word Nature; but I mean by Nature, only the aggregate action and product of many natural laws, and by laws the sequence of events as ascertained by us. With a little familiarity such superficial objections will be forgotten …As man can produce, and certainly has produced, a great result by his methodical and unconscious means of selection, what may not natural selection effect? Man can act only on external and visible characters: Nature, if I may be allowed to personify the natural preservation or survival of the fittest, cares nothing for appearances, except in so far as they are useful to any being. She can act on every internal organ, on every shade of constitutional difference, on the whole machinery of life. Man selects only for his own good: Nature only for that of the being which she tends …It may metaphorically be said that natural selection is daily and hourly scrutinising, throughout the world, the slightest variations; rejecting those that are bad, preserving and adding up all that are good; silently and insensibly working … We see nothing of these slow changes in progress, until the hand of time has marked the lapse of ages, and then so imperfect is our view into long-past geological ages, that we see only that the forms of life are now different from what they formerly were.
Darwin was criticized by some for being a teleologist—for believing that Nature was working with some long-term end in view—and, conversely, by others for constructing a Nature in which random, purposeless variation is key. (“The law of higgledy-piggledy,” the astronomer John Herschel dismissively called it.) People had real difficulty grasping the concept of natural selection. His motives, sincerity, honesty, and ability were all questioned. Many who criticized him did not understand his argument or the cumulative power of the data he invoked in its support. Many—including some of the most distinguished scientists of the day, among them, painfully, Adam Sedgwick, his old geology professor—rejected Darwin’s insight, not because the evidence was against it, but because of where it led: seemingly, to a world in which humans were degraded, souls denied, God and morality scorned, and monkeys, worms, and primeval ooze elevated; “a system uncaring of man.” Thomas Carlyle called it “a Gospel of dirt.”
None of these moral and theological criticisms is compelling, Darwin, Huxley, and others labored to show: In astronomy, we no longer believe that an angel pushes each planet around the Sun; the inverse square law of gravitation and Newton’s laws of motion suffice. But no one considers this a demonstration of the nonexistence of God, and Newton himself—except for a private reservation about the notion of the Trinity—was close to the conventional Christianity of his day. We are free to posit, if we wish, that God is responsible for the laws of Nature, and that the divine will is worked through secondary causes. In biology those causes would have to include mutation and natural selection. (Many people would find it unsatisfying, though, to worship the law of gravity.)
As the debate proceeded over the years, natural selection seemed less strange and less threatening. Increasing numbers of scientists, literary figures, and even clergymen were won over. But by no means all. In July 1871, The London Quarterly Review—which eleven years earlier had published Bishop Wilberforce’s anonymous diatribe—remained unreconstructed, wholly missing Darwin’s point. “Why should natural selection favor the preservation of useful varieties only? Such action cannot be referred to blind force; it can belong to mind alone.” Not only are evolution and natural selection rejected, but so is the newly discovered law of the conservation of energy,12 one of the foundations of modern physics.
Some of the underlying emotional reasons for rejecting natural selection were later vividly expressed by the playwright George Bernard Shaw:[T]he Darwinian process may be described as a chapter of accidents. As such, it seems simple, because you do not at first realize all that it involves. But when its whole significance dawns on you, your heart sinks into a heap of sand within you. There is a hideous fatalism about it, a ghastly and damnable reduction of beauty and intelligence, of strength and purpose, of honor and aspiration, to such casually picturesque changes as an avalanche may make in landscape, or a railway accident in a human figure. To call this Natural Selection is a blasphemy, possible to many for whom Nature is nothing but a casual aggregation of inert and dead matter, but eternally impossible to the spirits and souls of the righteous … If this sort of selection could turn an antelope into a giraffe, it could conceivably turn a pond full of amoebas into the French Academy.13
Fine words. But what if undreamed-of powers lie hidden in “inert and dead matter,” given 4 billion years of preserving what works? Such objections address (and far from compellingly) only the philosophical and social implications of natural selection, and not the evidence for it.
Naive Darwinists, including many capitalists, have self-servingly argued that oppression of the weak and the poor is a justified application of natural selection to human affairs. Naive biblical literalists, including some high officials charged with safeguarding the environment, have self-servingly argued that the destruction of non-human life is justified because the world will shortly end anyway, or because of the injunction in Genesis that we have “dominion … over every living thing.”14 But neither evolution nor the sacred books of various religions are invalidated because dangerous conclusions have been mistakenly drawn from them.
By the 1870s and 1880s, the evidence amassed by Darwin was changing many minds. Reviews were acknowledging “the certainty of the action of natural selection,” and even the possibility that humans evolved from some lower animal.15 However, some of the conclusions of Darwin’s 1871 book, The Descent of Man, stuck in the craws of even the most sympathetic reviewers. The debate, we find, had moved into a new arena:We deny [animals] … the power of reflecting of their own existences, or of inquiring into the nature of objects and their causes. We deny that they know that they know, or know themselves in knowing In other words, we deny them reason.
We return to this new level of debate later, and here note only how quickly many of the theological reservations about evolution had dissipated as Darwin’s argument became better understood. “Nothing is more remarkable,” he wrote in his Autobiography, “than the spread of scepticism or rationalism during the latter half of my life.”16
——
Of innumerable modern examples of natural selection in the real world, we select one—of interest because it involves humans and because it is the outcome of an experiment, although one performed inadvertently and under tragic circumstances. Malaria is endemic among nearly half the people of the world (just before World War II, the number was two thirds of all humans). It is a serious illness associated, in the absence of appropriate medicine or natural immunity, with high mortality. Even today several million people die from it each year. When the Plasmodium parasite causing malaria is injected (usually by mosquito bite) into the bloodstream, it eventually invades the red blood cells that carry oxygen from the lungs to every cell of the body. The red blood cells are rendered sticky, adhere to the walls of very small blood vessels, and are prevented from being circulated to the spleen—which destroys Plasmodium parasites. This is good for the parasites and bad for the humans.
People in malarial zones of tropical Africa, as elsewhere, have an adaptation to malaria, the sickle-cell trait. Under the microscope some of the red blood cells do look a little bit like sickles or croissants. But in someone with the sickle-cell trait, the altered red blood cells are surrounded by needle-like microscopic filaments that work, it is suggested, a little like a porcupine’s quills. The parasites are impaled or otherwise damaged, and the red blood cells—protected from the parasites’ sticky proteins—are then carried to the “untender mercies” of the spleen. With the parasites dead, many of the red blood cells return to their normal state, “unruffled” by the experience.17 However, when the genes for this trait are inherited from both parents, serious anemia, obstruction of the small blood vessels, and other infirmities often result. The trade-off, it is natural to think, is that it’s better for a part of the population to be seriously anemic than for most of the population to be dead of malaria.
In the seventeenth century slave traders from Holland arrived in the Gold Coast of West Africa (present-day Ghana). They bought or captured slaves in large numbers and transported them to two Dutch colonies—Curaçao in the Caribbean and Surinam in South America. There is no malaria in Curaçao, so the sickle-cell trait conferred anemia but no compensating advantage to the slaves brought there. But malaria is endemic in Surinam, and the sickle-cell trait was often the difference between life and death.
If now, some three centuries later, we examine the descendants of these slaves, we find that those in Curaçao show hardly any incidence of the trait, while it remains prevalent in Surinam. In Curaçao the sickle-cell trait was “selected against”; in Surinam, as in West Africa, it was “selected for.” We see natural selection operating on very short time scales, even for such slowly reproducing beings as humans,18 As always, there is a range of hereditary predispositions in a given population; the environment elicits some but not others. Evolution is the product of a hand-in-hand interplay between heredity and environment.
——
At the end of his life, Darwin called himself a theist, a believer in a First Cause. He had doubts, though:[C]an the mind of man, which has, as I fully believe, been developed from a mind as low as that possessed by the lowest animal, be trusted when it draws such grand conclusions?19
Evolution in no way implies atheism, although it is consistent with atheism. But evolution is clearly inconsistent with the literal truth of certain revered books. If we believe the Bible was written by people, and not dictated word-for-word to a flawless stenographer by the Creator of the Universe, or if we believe God might on occasion resort to metaphor for clarity, then evolution should pose no theological problem. But whether it poses a problem or not, the evidence for evolution—that it has happened, apart from the debate on whether uniformitarian natural selection fully explains how it happened—is overwhelming.
The Darwinian perspective is central to all of modern biology, from investigations of the molecular structure of DNA to studies of the behavior of apes and men.20 It connects us with our long-forgotten ancestors and our swarm of relatives, the millions of other species with whom we share the Earth. But the price exacted has been high, and there are still—especially in the United States—those who refuse to pay, and for very human and fathomable reasons. Evolution suggests that if God exists, God is fond of secondary causes and factotum processes: getting the Universe going, establishing the laws of Nature, and then retiring from the scene. A hands-on Executive seems to be absent; power has been delegated. Evolution suggests that God will not intervene, whether beseeched or not, to save us from ourselves. Evolution suggests we’re on our own—that if there is a God, that God must be very far away. This is enough to explain much of the emotional anguish and alienation that evolution has worked. We long to believe that there’s someone at the helm.
——
Darwin’s transcendantly democratic insight that all humans are descended from the same non-human ancestors, that we are all members of one family, is inevitably distorted when viewed with the impaired vision of a civilization permeated by racism. White supremacists seized on the notion that people with high abundances of melanin in their skin must be closer to our primate relatives than bleached people. Opponents of bigotry, perhaps fearing that there might be a grain of truth in this nonsense, were just as happy not to dwell on our relatedness to the apes. But both points of view are located on the same continuum: the selective application of the primate connection to the veldt and the ghetto, but never, ever, perish the thought, to the boardroom or the military academy or, God forbid, to the Senate chamber or the House of Lords, to Buckingham Palace or Pennsylvania Avenue. This is where the racism comes in, not in the inescapable recognition that, for better or worse, we humans are just a small twig on the vast and many-branched tree of life.
Natural selection has been misused by capitalists and communists, whites and blacks, Nazis and many others to grind this or that self-serving ideological axe. It’s not surprising that feminists feared that a Darwinian perspective would provide yet another cudgel for male seientists to hit women over the head with—about alleged inferiorities in mathematics or statecraft. But for all we know, such a perspective might reveal, that the raging hormonal imbalances that propel men to violence make them less than optimal for leadership of a modern state. If we believe sexism to be a prejudicial error, that fact will emerge from scientific examination, and we should favor its rigorous scrutiny by the methods of science.
Much of the recent controversy over the application of Darwinian ideas to human behavior has been motivated by the fear of such misuse by racists, sexists, and other bigots—as indeed happened with ghoulish and tragic consequences in World War II. However, the cure for a misuse of science is not censorship, but clearer explanation, more vigorous debate, and making science accessible to everyone. If some of our proclivities are inborn, as surely must be the case, it hardly follows that we cannot learn to modify, mitigate, enhance, or redirect the resulting behavior.
——
Vice-Admiral FitzRoy had been the British Board of Trade’s weatherman for more than a decade when his 1865 long-range forecast proved to be wildly, calamitously wrong. The proud, choleric FitzRoy took a terrible beating in the newspapers. When he could no longer bear the ridicule, he slit his throat, an early martyr to the predictive failures of meteorology. Although FitzRoy had spoken publicly against Darwin in the “creationism” controversy and despite the fact that the two men had not been face-to-face in eight years, Darwin took the news of FitzRoy’s suicide badly. What images from the youthful adventure they shared must have come to Darwin’s mind? “What a melancholy career he has run,” he observed to Hooker, “with all his splendid qualities.”21
On melancholia, too, Darwin was something of an expert. These years he was depressed, exhausted, and sick most of the time. Throughout this miserable period he was consistently productive and his relationships with Emma, the survivors among their ten children, and a great number of friends seemed none the worse for it. If anything, the letters they exchanged and their written recollections testify to an openness, an emphasis on the importance of feelings, a respect for children, a harmonious family life. His daughter remembered him saying that he hoped none of his children would ever believe something just because it was he who told it to them. “He kept up his delightful, affectionate manner towards us all his life,” his son Francis wrote. “I sometimes wonder that he could, with such an undemonstrative race as we are; but I hope he knew how much we delighted in his loving words and manner … He allowed his grown-up children to laugh with and at him, and was generally speaking on terms of perfect equality with us.”22
There were many who comforted themselves with the thought that in his last moments Darwin would renounce his evolutionary heresies and repent. There are still people today who piously believe that’s just what happened. Instead, Darwin faced death calmly and apparently without regret, saying on his deathbed “I am not the least afraid to die.”23
The family wished to bury him on their estate at Down, but twenty Members of Parliament, with the support of the Anglican Church, appealed to them to allow him to be interred at Westminster Abbey, a few feet away from Isaac Newton. You’ve got to hand it to the Church of England. It was an act of consummate grace. For you, they seemed to be saying, who have done the most to raise doubts about the truth of what we say, we reserve the highest honor—a respect for the correction of error that is, incidentally, characteristic of science when it is faithful to its ideals.
HUXLEY AND THE GREAT DEBATE
Thomas Henry Huxley was born to a large, struggling, dysfunctional family in the England of 1825, where class was destiny for almost everyone. His formal education consisted of two years of elementary school. But he had an insatiable hunger for knowledge and legendary self-discipline. At age seventeen, on an impulse, Huxley entered an open competition given by a local college, and was awarded the Silver Medal of the Pharmaceutical Society and a scholarship to study medicine at Charing Cross Hospital. Forty years later he was President of the Royal Society, then the foremost scientific organization in the world. He made fundamental contributions to comparative anatomy and many other fields, and was, along the way, inventor of the words “protoplasm” and “agnostic.” Through his whole life he was committed to teaching science to the public. (More than one member of the upper classes was known to don shabby clothes in order to gain admittance to his lectures for working people.) He taught that a fair scientific examination of the facts demolished European claims of racial superiority.24 At the end of the American Civil War, he wrote that while the slaves might now be free, half of the human species—women—had yet to be emancipated.*
One of Huxley’s interests had been the idea that all animals, including us, were “automata,” carbon-based robots, whose “states of consciousness … are immediately caused by molecular changes of the brain-substance.”25 Darwin closed his last letter to him with these words: “Once again, accept my cordial thanks, my dear old friend. I wish to God there were more automata in the world like you.”26
“If I am to be remembered at all,” Huxley confided late in life, “I would rather it should be as ‘a man who did his best to help the people’ than by any other title.”27 What he is actually best remembered for is delivering the punch line in the decisive debate that gained acceptance for Darwin’s ideas.
——
The Huxley/Wilberforce debate is the grand climactic scene in the 1930s Hollywood movie version that might be imagined of Darwin’s life:
A small item on the front page of The Daily Oxonian: “Annual Meeting of British Association for the Advancement of Science to Be Held Tomorrow.” The dateline reads June 29, 1860. Front page begins to spin like a roulette wheel.
Dissolve to reveal that we are following the highly imaginative, although slightly shady Robert Chambers (played by Joseph Cotten) as he makes his way down an Oxford street. He is jostled by another man and just as he turns in annoyance, he realizes that it is none other than the pugnacious Thomas Henry Huxley (Spencer Tracy), whose conviction with regard to the truth of his friend Darwin’s controversial theory is so fierce it will one day earn him the nickname “Darwin’s Bulldog.”
Rascal that he is, Chambers can’t resist asking Huxley if he’ll he attending Drapers reading at the British Association meeting. The title is to be “The Intellectual Development of Europe with Reference to the Views of Mr. Darwin.” Huxley claims he’s too busy.
Knowingly, Chambers allows that “ ‘Soapy Sam’ Wilberforce is sure to be there.”
Huxley, growing more defensive, insists that it would be a waste of time.
Chambers says slyly, “Deserting the cause, Huxley?”
Piqued, Huxley makes his excuses and walks off.
The following day. The doors to the great hall are thrown open. The place is packed but only one voice is heard. We pan in for a tight close-up of the Bishop of Oxford, Samuel Wilberforce (George Arliss). Fingers in lapels, he turns pointedly to Huxley (who is of course there, despite his protestations of scheduling conflicts) and with arch courtesy begs to know “whether it is through your grandfather or your grandmother that you claim your descent from a monkey?” Grasping the smarmy nuance of “grandmother,” the crowd utters low “ooh’s” and turns its attention to Huxley.
Still seated, Huxley turns to the man next to him and, almost winking, murmurs, “The Lord hath delivered him into mine hands.” Rising and looking Wilberforce squarely in the eye, he says: “I would rather be the offspring of two apes than be a man and afraid to face the truth.”
The crowd has never seen a bishop insulted to his face before. Stunned reaction. Ladies faint. Men shake their fists. Chambers in the crowd, positively gleeful. But wait. There’s someone else standing up. Why, it’s Vice-Admiral Robert FitzRoy (Ronald Reagan), back in England after his term as Governor of New Zealand. “I was arguing with Charles Darwin and his crazy ideas thirty years ago on the Beagle.” And then, brandishing his Bible: “This and this alone is the source of all truth.” More clamor.
Now it’s Hookers turn (Henry Fonda). Sincerely, “I knew this theory fifteen years ago. I was then entirely opposed to it; I argued against it again and again; but since then I have devoted myself unremittingly to natural history; in its pursuit I have traveled around the world. Facts in this science which before were inexplicable to me became one by one explained by this theory, and conviction has been thus gradually forced upon an unwilling convert.”
The camera pulls out of the great hall. Dissolve to a close-up of a finch perched on the branch of a tree. A bearded man (Ronald Colman), kindly, dressed in rural gentleman’s hat and cape, but with a muffler despite the June weather, is staring lovingly up at the bird. He hardly seems to hear the voice of his wife (Billie Burke), high-pitched, affectionate, calling from the great house, off-camera: “Charles … CHARLES … Trevor is here with news from that meeting at Oxford.” He casts one appreciative look back at the finch before finally walking off to the house …28
* “[G]irls have been educated either to be drudges or toys, beneath men; or a sort of angels above him The possibility that women are meant to be men’s comrades, their fellows, and their equals, so far as Nature puts no bar on that equality, does not seem to have entered into the minds of those who have had the conduct of the education of girls.” The first step to a better world, he said, was “Emancipate girls” Their hair “will not curl less gracefully outside the head by reason of there being brains within”29
Chapter 5
LIFE IS JUST A THREE-LETTER WORD
Who first drives life to begin its journey?
The Kena Upanishad
(8th to 7th centuries B.C., India)1
Who’s aware of mutability?
Not even Buddhas.
DAITETSU
(1333–1408, Japan)2
In a shaft of sunlight, even when the air is still, you can sometimes see a tribe of dust motes dancing. They move in zigzag paths as if animated, motivated, propelled by some small but earnest purpose. Some of the followers of Pythagoras, the ancient Greek philosopher, thought that each mote had its own immaterial soul that told it what to do, just as they thought that each human has a soul that gives us direction and tells us what to do. Indeed, the Latin word for soul is anima—it is something similar in many modern languages—from which come such English words as “animate” and “animal.”
In fact, those motes of dust make no decisions, have no volition. They are instead the passive agents of invisible forces. They’re so tiny that they’re battered about by the random motion of molecules of air, which have a slight preponderance of collisions first on one side of the mote and then on the other, propelling them, with what looks to us as some mix of intention and indecision, through the air. Heavier objects—threads, say, or feathers—cannot much be jostled by molecular collisions; if not wafted by a current of air, they simply fall.
The Pythagoreans deceived themselves. They did not understand how matter works on the level of the very small, and so—from a specious and oversimple argument—they deduced a ghostly spirit that pulls the strings. When we look around us at the living world, we see a profusion of plants and animals, all seemingly designed for specific ends and single-mindedly devoted to their own and their offspring’s survival—intricate adaptations, an exquisite match of form to function. It is natural to assume that some immaterial force, something like the soul of a dust mote, but far grander, is responsible for the beauty, elegance, and variety of life on Earth, and that each organism is propelled by its own, appropriately configured, spirit. Many cultures all over the world have drawn just such a conclusion. But might we here, as did the ancient Pythagoreans, be overlooking what actually goes on in the world of the very small?
We can believe in animal or human souls without holding to evolution, and vice versa. But if we examined life more closely, might we be able to understand at least a little of how it works and how it came to be, purely in terms of its constituent atoms? Is something “immaterial” present? If so, is it in every beast and vegetable, or just in humans? Or is life no more than a subtle consequence of physics and chemistry?
——
One educated look at how the molecule is shaped and you can figure out what it’s for. Even at the molecular level, function follows form. Before us is a detailed blueprint of breathtaking precision for building complex molecular machines. The molecule is very long and composed of two intertwined strands. Running the length of each strand is a sequence made of four smaller molecular building blocks, the nucleotides—which humans conventionally represent by the letters A, C, G, and T. (Each nucleotide molecule actually looks like a ring, or two connected rings, made of atoms.) On and on the sequence goes, for billions of letters. A short segment of it might read something like this:ATGAAGTCGATCCTAGATGGCCTTGCAGACACCACCTTCCGTACCATCACCACAGACCTCCT …
Along the opposite strand there’s an identical sequence, except that wherever nucleotide A was in the first strand, it’s T in the second; and instead of G it’s always C. And vice versa. Like this:TACTTCAGCTAGGATCTACCGGAACGTCTGTGGTGGAAGGCATGGTAGTGGTGTCTGGAGGA …
This is a code, a long sequence of words written out in an alphabet of only four letters. As in ancient human writing, there are no spaces between the words. Inside this molecule there are, written in a special language of life, detailed instructions—or rather, two copies of the same detailed instructions, because the information in one strand can surely be reconstructed from the information in the other, once you understand the simple substitution cipher. The message is redundant, bespeaking care, conservatism; it conveys a sense that whatever it is saying must be preserved, treasured, passed intact to future generations.
Almost every issue of leading scientific journals such as Science or Nature contains the newly uncovered ACGT sequence of some part of the genetic instructions of some lifeform or other. We’re slowly beginning to read the genetic libraries. The library of our own hereditary information, the human genome, is also becoming increasingly revealed, but there’s a lot to read: Every cell of your body has a full set of instructions about how to manufacture you, encoded in a very compressed format—it takes only a picogram (a trillionth of a gram) of this molecule to specify everything you’ve inherited from your ancestors, back to the first beings of the primeval sea. Yet, there are almost as many nucleotide building blocks, or “letters,” in the microminiaturized genetic information in any of your cells as there are people on Earth.
All words in the genetic code are three letters long. So, if we insert the implicit spaces between the words, the beginning of the first message above looks like this:ATG AAG TCG ATC CTA GAT GGC CTT GCA GAC ACC ACC TTC CGT ACC …
Since there are only four kinds of nucleotides (A, C, G, and T), there are at most only 4 × 4 × 4 = 64 possible words in this language. But if the order in which the words are put together is central to the meaning of the message, you can say a great deal with only a few dozen different words. With messages that are a billion carefully selected words long, what might be possible? You must take care in reading the message, though: With no spaces between the words, if you start reading at the wrong place, the meaning will surely change and a lucid message might be reduced to gibberish. This is one reason the giant molecule has special code words meaning “START READING HERE” and “STOP READING HERE.”
As you watch the molecule closely you observe that the two strands occasionally unwind and unzip. Each copies the other, using available A, C, G, and T raw materials—like the metal type stored in an old-fashioned printer’s box Now, instead of one pair, there are two pairs of identical messages. As well as utilizing a language and embodying a complex, redundantly encoded text, this molecule is a printing press.
But what’s the use of a message if nobody reads it? Through copying links and relays, the sequences of As, Cs, Gs, and Ts are revealed to be the job orders and blueprints for the construction of particular molecular machine tools. Some sequences are orders to itself—arranging for the giant molecule to twist and kink so it can then issue a particular set of instructions. Other sequences ensure that the instructions will be followed to the letter. Many three-letter words specify a particular amino acid (or a punctuation mark, like the one that signifies “START”) out there in the surrounding cell, and the sequence of words encoded determines the sequence of amino acids that will make up the protein machine tools that control the life of the cell. Once such a protein is manufactured, it usually twists and folds itself into a three-dimensional shape spring-loaded for action. Sometimes another protein bends it into shape. These machine tools, at a pace determined both by the long double-stranded molecule and by the outside world, then proceed on their own to strip other molecules down, to build new ones up, to help communicate molecular or electrical messages to other cells.
This is a description of some of the humdrum, everyday action in each of the ten trillion or so cells of your body, and those of nearly every other plant, animal, and microbe on Earth. The tiny machine tools perform stupefying feats of molecular transformation. They are submicroscopic and made of organic molecules, rather than macroscopic and made of silicates or steel, but at the molecular level life was tool-using and tool-making from the start.
The long self-replicating double-stranded molecule with the complex message is a sequence of genes, a little like beads on a string. Chemically, it is a nucleic acid (here, the kind abbreviated DNA, which stands for deoxyribonucleic acid). The two strands, wrapped around each other, comprise the famous DNA double helix. The nucleotide bases in DNA are called adenine, cytosine, guanine, and thymine, which is where the abbreviations A, C, G, and T come from. Their names date back to long before their key role in heredity was understood. Guanine, for example, is named unpretentiously after guano, the bird droppings from which it was first isolated. It is a double ring molecule made of five carbon atoms, five hydrogens, five nitrogens, and one oxygen. There’s something like a billion guanines (and roughly equal numbers of As, Cs, and Ts) in the genes of any one of your cells.
Except for some oddball microbes, the genetic information of every organism on Earth is contained in DNA—a molecular engineer of formidable, even awesome talents. One (very long) sequence of As, Cs, Gs, and Ts contains all the information for making a person; another such sequence, nearly identical, for a chimpanzee; others, not so different, for a wolf or a mouse. In turn, the sequences for nightingales, sidewinders, toads, carp, scallops, forsythia, club mosses, seaweed, and bacteria are still more different—although even they collectively hold many sequences of As, Cs, Gs, and Ts in common. A typical gene, controlling or contributing to one specific hereditary trait, might be a few thousand nucleotides long. Some genes may comprise more than a million As, Cs, Gs, and Ts. Their sequences specify the chemical instructions for, say, manufacturing the organic pigments that make eyes brown or green; or extracting energy out of food; or finding the opposite sex.
How this complex information got into our cells, and how arrangements were made for its precise replication and the obedient implementation of its instructions, is tantamount to asking how life evolved. Nucleic acids were unknown when The Origin of Species was first published, and the messages they contain were not to be deciphered for another century. They constitute the demonstration and definitive record of evolution that Darwin sought. Scattered in the ACGT sequences of the diverse lifeforms of our planet is an incomplete history of the evolution of life—not the blood, bones, brains, and the other manufactured products of the genetic factories, but the actual production records, the master instructions themselves, slowly varying at different rates in different beings in different epochs.
Because evolution is conservative and reluctant to tamper with instructions that work, the DNA code incorporates documents—job orders and blueprints—dating back to remote biological antiquity. Many passages have faded. In some places there are palimpsests, where remains of ancient messages can be seen peeking out from under newer ones. Here and there a sequence can be found that is transposed from a different part of the message, taking on a different shade of meaning in its new surrounds; words, paragraphs, pages, whole volumes have been moved and reshuffled. Contexts have changed. The common sequences have been inherited from remote times. The more distinct the corresponding sequences are in two different organisms, the more distantly related they must be.
These are not only the surviving annals of the history of life, but also handbooks of the mechanisms of evolutionary change. The field of molecular evolution—only a few decades old—permits us to decode the record at the heart of life on Earth. Pedigrees are written in these sequences, carrying us back not a few generations, but most of the way to the origin of life. Molecular biologists have learned to read them and to calibrate the profound kinship of all life on Earth.5 The recesses of the nucleic acids are thick with ancestral shadows.
We can now almost follow the itinerary of the naturalist Loren Eiseley:Go down the dark stairway out of which the race has ascended. Find yourself at last on the bottommost steps of time, slipping, sliding, and wallowing by scale and fin down into the muck and ooze out of which you arose. Pass by grunts and voiceless hissings below the last tree ferns. Eyeless and earless, float in the primal waters, sense sunlight you cannot see and stretch absorbing tentacles toward vague tastes that float in water.6
——
A particular sequence of As, Cs, Gs, and Ts is in charge of making fibrinogen, central to the clotting of human blood. Lampreys look something like eels (although they are far more distant relations of ours than eels are); blood circulates in their veins too; and their genes also contain instructions for the manufacture of the protein fibrinogen. Lampreys and people had their last common ancestor about 450 million years ago. Nevertheless, most of the instructions for making human fibrinogen and for making lamprey fibrinogen are identical. Life doesn’t much fix what isn’t broken. Some of the differences that do exist are in charge of making parts of the molecular machine tools that hardly matter—something like the handles on two drill presses being made of different materials with different brand names, while the guts of the two are identical.
Or here, to take another example, are three versions of the same message,7 taken from the same part of the DNA of a moth, a fruit fly, and a crustacean:
Moth:GTC GGG CGC GGT CAG TAC TTG GAT GGG TGA CCA CCT GGG AAC ACC GCG TGC CGT TGG …
Fruit fly:GTC GGG CGC GGT TAG TAC TTA GAT GGG GGA CCG CTT GGG AAC ACC GCG TGT TGT TGG …
Crustacean:GTC GGG CCC GGT CAG TAC TTG GAT GGG TGA CCG CCT GGG AAC ACC GGG TGC TGT TGG …
Compare these sequences and recall how different a moth is from a lobster. But these are not the job orders for mandibles or feet—which could hardly be closely similar in moths and lobsters. These DNA sequences specify the construction of the molecular jigs on which newly forming molecules are laid out under the ministrations of the molecular machine tools. Down at this level, it’s not absurd that moths and lobsters might have closer affinities than moths and fruit flies. The comparison of moth and lobster suggests how slow to change, how conservative the genetic instructions can be. It’s a long time ago that the last common ancestor of moths and lobsters scudded across the floor of the primeval abyss.
We know what every one of those three-letter ACGT words means—not just which amino acids they code for, but also the grammatical and lexigraphical conventions employed by life on Earth. We have learned to read the instructions for making ourselves—and everybody else on Earth. Take another look at “START” and “STOP.” In organisms other than bacteria, there’s a particular set of nucleotides that determine when DNA should start making molecular machine tools, which machine tool instructions should be transcribed, and how fast the transcription should go. Such regulatory sequences are called “promoters” and “enhancers.” The particular sequence TATA, for example, occurs just before the place where transcription is to occur. Other promoters are CAAT and GGGCGG. Still other sequences tell the cell where to stop transcribing.8
You can see that the substitution of one nucleotide for another might have only minor consequences—you could, for example, substitute one structural amino acid for another (in the “handle” of the machine tool) and in no way change what the resulting protein does. But it could also have a catastrophic effect: A single nucleotide substitution might convert the instructions for making a particular amino acid into the signal to stop the transcription; then, only a fragment of the molecular machine in question will be manufactured, and the cell might be in trouble. Organisms with such altered instructions will probably leave fewer offspring.
The subtlety and nuance of the genetic language is stunning. Sometimes there seem to be overlapping messages using the same letters in the same sequence, but with different functional import depending on how it’s read: two texts for the price of one. Nothing this clever occurs in any human language. It’s as if a long passage in English had two completely different meanings,9 something like
ROMAN CEMENT TOGETHER NOWHERE …
and
ROMANCEMENT TO GET HER NOW HERE …
but much better—on and on for pages, perfectly lucid and grammatical in both modes, and, we think, beyond the skill of any human writer. The reader is invited to try.
In “higher” organisms, many long sequences seem to be nonfunctional genetic nonsense. They lie after a “STOP” and before the next “START” and generally remain ignored, forlorn, untranscribed. Maybe some of these sequences are garbled remnants of instructions that, long ago, in our distant ancestors, were important or even keys to survival, but that today are obsolete and useless.* Being useless, these sequences evolve quickly: Mutations in them do no harm and are not selected against. Maybe a few of them are still useful, but elicited only under extraordinary circumstances. In humans some 97% of the ACGT sequence is apparently good for nothing. It’s the remaining 3% that, as far as genetics goes, makes us who we are.
Startling similarities among the functional sequences of As, Cs, Gs, and Ts are seen throughout the biological world, similarities that could not have come about unless—beneath the apparent diversity of life on Earth—there was an underlying and fundamental unity. That unity exists, it seems clear, because every living thing on Earth is descended from the same ancestor 4 billion years ago; because we are all kin.
But how could machines of such elegance, subtlety, and complexity ever arise? The key to the answer is that these molecules are able to evolve. When one strand is making a copy of the other, sometimes a mistake occurs and the wrong nucleotide—an A, say, instead of a G—will be inserted into the newly assembled sequence. Some of them are honest replication errors—good as it is, the machinery isn’t perfect. Some are induced by a cosmic ray or another kind of radiation, or by chemicals in the environment. A rise in temperature might slightly increase the rate at which molecules fall to pieces, and this could lead to mistakes. It even happens that the nucleic acid generates a substance that alters itself—perhaps thousands or millions of nucleotides away.
Uncorrected mistakes in the message are propagated down to future generations. They “breed true.” These changes in the sequence of As, Cs, Gs, and Ts, including alterations of a single nucleotide, are called mutations. They introduce a fundamental and irreducible randomness into the history and nature of life. Some mutations may neither help nor hinder, occurring, for example, in long, repetitive sequences—containing redundant information—or in what we’ve called the handles of the molecular machine tools, or in untranscribed sequences between STOP and START. Many other mutations are deleterious. If you’re crafting superb machine tools and, while you’re not looking, someone introduces a few random changes into the computer instructions for manufacture, there isn’t much chance that the resulting machines, built according to the new, garbled instructions, will work better than the earlier model. Enough random changes in a complex set of instructions will cause serious harm.
But a few of the random changes, by luck, prove advantageous. For example, the sickle-cell trait we mentioned in the last chapter is caused by the mutation of a single nucleotide in the DNA, generating a difference of a single amino acid in the hemoglobin molecules that nucleotide helps code for; this in turn changes the shape of the red blood cell and interferes with its ability to carry oxygen, but at the same time it eventually kills the plasmodium parasites those cells contain. A lone mutation, one particular T turning into an A, is all it takes.
And, of course, not just the hemoglobin in red blood cells, but every part of the body, every aspect of life, is instructed by a particular DNA sequence. Every sequence is vulnerable to mutation. Some of these mutations cause changes more far-reaching than the sickle-cell trait, some less. Most are harmful, a few are helpful, and even the helpful ones may—like the sickle-cell mutation—represent a tradeoff, a compromise.
This is a principal means by which life evolves—exploiting imperfections in copying despite the cost. It is not how we would do it. It does not seem to be how a Deity intent on special creation would do it. The mutations have no plan, no direction behind them; their randomness seems chilling; progress, if any, is agonizingly slow. The process sacrifices all those beings who are now less fit to perform their life tasks because of the new mutation—crickets who no longer hop high, birds with malformed wings, dolphins gasping for breath, great elms succumbing to blight. Why not more efficient, more compassionate mutations? Why must resistance to malaria carry a penalty in anemia? We want to urge evolution to get to where it’s going and stop the endless cruelties. But life doesn’t know where it’s going. It has no long-term plan. There’s no end in mind. There’s no mind to keep an end in mind. The process is the opposite of teleology. Life is profligate, blind, at this level unconcerned with notions of justice. It can afford to waste multitudes.
—
The evolutionary process could not have gone very far, though, if the mutation rate had been too high. In any given environment, there must be a delicate balance—simultaneously avoiding mutation rates so high that instructions for essential molecular machine tools are quickly garbled, and mutation rates so low that the organism is unable to retool when changes in the external environment require it to adapt or die.
There is a vast molecular industry that repairs or replaces damaged or mutated DNA. In a typical DNA molecule, hundreds of nucleotides are inspected every second and many nucleotide substitutions or errors corrected. The corrections are then themselves proofread, so that there is only about one error in every billion nucleotides copied. This is a standard of quality control and product reliability rarely reached in, say, publishing or automobile manufacture or microelectronics. (It is unheard of that a book this size, containing around a million letters would have no typographical errors; a 1% failure rate is common in automobile transmissions manufactured in America; advanced military weapons systems are typically down for repair some 10% of the time.) The proofreading and correction machinery devotes itself to DNA segments that are actively involved in controlling the chemistry of the cell, and mainly ignores nonfunctioning, largely untranscribed, or “nonsense” sequences.
The unrepaired mutations steadily accumulating in these normally silent regions of the DNA may lead (among other causes) to cancer and other illnesses, should the “STOP” be ignored, the sequence turned on, and the instructions carried out. Long-lived organisms such as humans devote considerable attention to repairing the silent regions; short-lived organisms such as mice do not, and often die filled with tumors.10 Longevity and DNA repair are connected.
Consider an early one-celled organism floating near the surface of the primeval sea—and thereby flooded with solar ultraviolet radiation. A small segment of its nucleotide sequence reads, let’s say, … TACTTCAGCTAG …
When ultraviolet light strikes DNA, it often binds two adjacent T nucleotides together by a second route, preventing DNA from exercising its coding function and getting in the way of its ability to reproduce itself: … TAC
CAGCTAG …
The molecule literally gets tied up in knots. In many organisms enzymatic repair crews are called in to correct the damage. There are three or four different kinds of crews, each specialized for repairing a different kind of damage. They snip out the offending segment and its adjacent nucleotides (CC, say) and replace it with an unimpaired sequence (CTTC). Protecting the genetic information and making sure it can reproduce itself with high fidelity is a matter of the highest priority. Otherwise, useful sequences, tried-and-true instructions, essential for the adaptation of organism to environment, may be quickly lost by random mutation. Proofreading and repair enzymes correct damage to the DNA from many causes, not just UV light. They probably evolved very early, at a time before ozone, when solar ultraviolet radiation was a major hazard to life on Earth. Early on, the rescue squads themselves must have undergone fierce competitive evolution. Today, up to a certain level of irradiation and exposure to chemical poisons, they work extremely well.
Advantageous mutations occur so rarely that sometimes—especially in a time of swift change—it may be helpful to arrange for an increased mutation rate. Mutator genes in such circumstances can themselves be selected for—that is, those varieties with active mutator genes serve up a wider menu of organisms for selection to draw upon, and serve them up faster. Mutator genes are nothing mysterious; some of them, for example, are just the genes ordinarily in charge of proofreading or repair. If they fail in their error-correcting role, the mutation rate, of course, goes up. Some mutator genes encode for the enzyme DNA polymerase, which we will meet again later; it’s in charge of duplicating DNA with high fidelity. If that gene goes bad, the mutation rate may rise quickly. Some mutator genes turn As into Gs; others, Cs into Ts, or vice versa. Some delete parts of the ACGT sequence. Others accomplish a frame shift, so the genetic code is read, three nucleotides at a time, as usual, but from a starting point offset by one nucleotide—-which can change the meaning of everything.11
This is a marvel of self-reflexive talent. Even very simple microorganisms have it. When conditions are stable, the precision of reproduction is stressed; when there’s an external crisis that needs attending to, an array of new genetic varieties is generated. It might look as if the microbes are conscious of their predicament, but they haven’t the foggiest notion of what’s going on. Those with appropriate genes preferentially survive. Active mutators in placid and stable times tend to die off. They are selected against. Reluctant mutators in quickly changing times are also selected against. Natural selection elicits, evokes, draws forth a complex set of molecular responses that may superficially look like foresight, intelligence, a master Molecular Biologist tinkering with the genes; but in fact all that is happening is mutation and reproduction, interacting with a changing external environment.
——
Since favorable mutations are served up so slowly, major evolutionary change will ordinarily require vast expanses of time. There are, as it turns out, ages available. Processes that are impossible in a hundred generations may be inevitable in a hundred million. “The mind cannot grasp the full meaning of the term of a million or a hundred million years,” Darwin wrote in 1844, “and cannot consequently add up and perceive the full effects of small successive variations accumulated during almost infinitely many generations.”12
The time scale problem was formidable when Darwin wrote. Lord Kelvin, the greatest physicist of the late Victorian age, authoritatively announced that the Sun—and therefore life on Earth—could be no more than about a hundred million (later downgraded to thirty million) years old. The fact that he provided a quantitative argument, plus his enormous prestige, intimidated many geologists and biologists, Darwin included. Is it more probable, Kelvin asked,13 that straightforward physics was in error, or that Darwin was wrong? There was in fact no error in Kelvin’s physics, but his starting assumptions were mistaken. He had assumed that the Sun shines because of meteorites and other debris falling into it. There was not the faintest hint in the physics of Kelvin’s time of thermonuclear reactions; even the existence of the atomic nucleus was unknown. As late as the first decade of the twentieth century it was believed that the Earth was only 100 million years old, instead of 4.5 billion, and that the mammals had supplanted the dinosaurs only 3 million years ago, instead of 65 million.
On the basis of these misconceptions, Darwin’s critics argued—properly—that even if evolution worked in principle, there might not be enough time for it to do its stuff in practice.* On an Earth created less than ten thousand years ago, it was absurd to imagine that species flowed one into another, that the slow accumulation of mutations could explain the varied forms of life on Earth. It made sense, not merely as an expression of faith, but as legitimate science, to conclude that each species must have been separately created by the same Maker who had only a moment before created the Universe.
The breakup of rocks by the waves, the transport of rock powder by the winds, lava flowing down the sides of a volcano—if the Earth is only a few thousand years old, such processes cannot have much reworked the face of our planet. But the most casual look at the landforms of Earth reveals a profound reworking. So if you imagined from biblical chronology that the world was formed around the year 4000 B.C., it made sense to be a catastrophist—and believe that immense cataclysms, unknown in our time, have occurred in earlier history. The Noachic flood, as we’ve mentioned, was a popular example. If, though, the Earth is 4.5 billion years old, the cumulative impact of small, nearly imperceptible changes over the course of ages could wholly alter our planet’s surface.
Once the time scale for the terrestrial drama had been extended to billions of years, much that had once seemed impossible could now be readily explained as the concatenation of apparently inconsequential events—the footfalls of mites, the settling of dust, the splatter of raindrops. If, in a year, wind and water rub a tenth of a millimeter off the top of a mountain, then the highest mountain on Earth can be flattened in ten million years. Catastrophism gave way to uniformitarianism, championed by Lyell in geology and by Darwin in biology. The accumulation of vast numbers of random mutations was now inevitable, unavoidable. Great cataclysms were discredited and special creation became, both in geology and biology, a redundant and unnecessary hypothesis.
Many advocates of uniformitarianism denied that quick and violent biological change had ever occurred. T. H. Huxley, for example, wrote, “There has been no grand catastrophe—no destroyer has swept away the forms of life of one period, and replaced them by a totally new creation: but one species has vanished and another has taken its place; creatures of one type of structure have diminished, those of another have increased, as time has passed on.”14 In the light of modern evidence, he was right in general, right for most of the history of the Earth. But he went too far; clearly it is possible to acknowledge the importance of slow, cumulative, background change without denying the possibility of occasional global cataclysms.
In recent years it has become increasingly evident that catastrophes have swept over the Earth, generating vast alterations both in land-forms and in life. Major worldwide discontinuities in the record in the rocks are readily explained by such catastrophes; and abrupt transitions in the forms of life on Earth, occurring in the same epoch, are naturally understood as mass extinctions, times of great dyings. (Of these, the late Permian is the most extreme example, and the late Cretaceous—when the dinosaurs were all snuffed out—the best-known). Previous ecologies are then supplanted wholesale by new teams of organisms. The fossil record shows that long periods of very slow evolutionary change are often interrupted by rarer, episodic intervals of quick change, the “punctuated equilibrium” of Niles Eldredge and Stephen J. Gould.15 We live on a planet in which both catastrophes and uniform change have played their roles. In the purported distinction between all-at-once and slow-and-steady, as in much else, the truth embraces seemingly antithetical extremes.
The case for special creation has not been strengthened by this new balance. Catastrophism is an awkward business for biblical literalists: It suggests imperfections in either the design or the execution of the Divine Plan. Mass extinctions permit the survivors to evolve quickly, occupying ecological niches formerly closed to them by the competition. The painstaking selection of mutations continues, catastrophes or no catastrophes. But the wiping out of whole species, genera, families and orders of life, the randomness of mutation, the infelicities in the molecular machinery of life, and the slow evolutionary fiddling displayed in the fossil record—of trilobites, say, or crocodiles—all reveal a tentativeness, a hesitancy, an indecision that hardly seems consistent with the modus operandi of an omnipotent, omniscient, “hands-on” Creator.
——
Why are many cave fish, moles, and other animals that live in perpetual darkness blind, or nearly so? At first the question seems ill-conceived, since no adaptive reward would attend the evolution of eyes in the dark. But some of these animals do have eyes, only they’re beneath the skin and don’t work. Others have no eyes at all, although anatomically it’s clear that their ancestors did. The answer seems to be that they all evolved from sighted creatures that entered a new and promising habitat—a cave, say, lacking competitors and predators. There, over many generations, no penalty is paid for the loss of eyesight. So what if you’re blind, as long as you live in pitch darkness? Mutations for blindness, which must be occurring all the time (there being many possible malfunctions in the genetic instructions for vision—in eye, retina, optic nerve, and brain), are not selected against. A one-eyed man has no advantage in the kingdom of darkness.
Similarly, whales have small, internal, and wholly useless pelvises and leg bones, and snakes have four vestigial internal feet. (In the mambas of Southern Africa a single claw from each rudimentary limb breaks through the scaly skin to plain view.) If you swim or slither and never walk anymore, mutations for the withering away of feet do you no harm. They are not selected against. They might even be selected for (feet can be in the way when you’re pouring down a narrow hole). Or if you’re a bird that finds itself on an island devoid of predators, no penalty is levied for the steady atrophy, generation after generation, of wings (until European sailors arrive and club you all to death).
Mutations are occurring all the time for the loss of all sorts of functions. If there’s no disadvantage attached to these mutations, they can establish themselves in the population. Some will even be helpful—shedding formerly useful machinery, say, that is no longer worth the effort of maintaining. There must also be enormous numbers of mutations for biochemical incompetence and other major dysfunctions which result in beings that never survive their embryonic stages. They die before they’re born. They’re rejected by natural selection before the biologist can examine them. Relentless, draconian winnowing is occurring all around us. Selection is a school of hard knocks.
Evolution is just trial and error—but with the successes encouraged and proliferated, the failures ruthlessly extirpated, and prodigious vistas of time available for the process to work itself out. If you reproduce, mutate, and reproduce your mutations, you must evolve. You have no choice in the matter. You get to keep playing the game of life only if you keep winning; that is, if you keep leaving descendants (or close relatives). One break in the train of generations, and you and your particular, idiosyncratic DNA sequences are condemned without hope of reprieve.
——
The English-language edition of this book is printed in letters that trace back to western Asia, and in a language primarily derived from Central Europe. But this is solely a matter of historical accident. The alphabet might not have been invented in the ancient Near East if there had not been a thriving mercantile culture there, if there had been no need for systematic records of commercial transactions. Spanish is spoken in Argentina, Portuguese in Angola, French in Quebec, English in Australia, Chinese in Singapore, a form of Urdu in Fiji, a form of Dutch in South Africa, and Russian in the Kuriles only because of a contingent sequence of historical events, some quite unlikely. Had they run a different course, other languages might be spoken in these places today. The Spanish, French, and Portuguese languages in turn depend on the fact that the Romans had imperial ambitions; English would be very different if Saxons and Normans had not been bent on overseas conquest; and so on. Language depends on history.
That a planet the size of the Earth is a sphere and not a cube, that a star the size of the Sun mainly emits visible light, that water is a solid and a liquid and a gas on any world at the surface temperature and pressure of the Earth—these facts are all readily understood from a few simple principles of physics. They are not contingent truths. They do not depend on a particular sequence of events that could just as well have gone some other way. Physical reality has a permanence and stability, an obsessive regularity to it, while historical reality tends to be fickle and fluid, less predictable, less rigidly determined by those laws of Nature we know. Something like accident or chance seems to play a major role in issuing marching orders to the flow of historical events.
ТЕЛЕГРАМКанал с обзорами, анонсами новинок и книжными подборками
Книжный Вестник
Бот для удобного поиска книг (если не нашлось на сайте)
Поиск книг
Свежие любовные романы в удобных форматах
Любовные романы
О психологии, саморазвитии и личностном росте
Саморазвитие
Детективы и триллеры, все новинки
Детективы
Фантастика и фэнтези, все новинки
Фантастика
Отборные классические книги
Классика
ВКОНТАКТЕБиблиотека с любовными романами, которая наверняка придётся по вкусу женской части аудитории
Любовные романы
Библиотека с фантастикой и фэнтези, а также смежных жанров
Фантастика
Самые популярные книги в формате фб2
Топ фб2
книги